EMAIL THIS PAGE TO A FRIEND

P2RY1

purinergic receptor P2Y, G-protein coupled, 1

96 Gene Product Result for
Synonyms: P2Y1
UniProtKB ID: P47900
Gene ID:
Human(5028) Summary: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor functions as a receptor for extracellular ATP and ADP. In platelets binding to ADP leads to mobilization of intracellular calcium ions via activation of phospholipase C, a change in platelet shape, and probably to platelet aggregation. [provided by RefSeq, Jul 2008]
Mouse(18441) purinergic receptor P2Y, G-protein coupled 1
Rat(25265) purinergic receptor P2Y, G-protein coupled, 1
chicken(396275) purinergic receptor P2Y, G-protein coupled, 1
dog(449621) purinergic receptor P2Y, G-protein coupled, 1
domestic cat(101090795) purinergic receptor P2Y, G-protein coupled, 1
cow(281963) purinergic receptor P2Y, G-protein coupled, 1
sheep(101114407) purinergic receptor P2Y, G-protein coupled, 1
Domestic Rabbit(100353792) purinergic receptor P2Y, G-protein coupled, 1
domestic guinea pig(100135592) purinergic receptor P2Y, G-protein coupled 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S2671 Suramin sodium salt ≥99% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002563 Rosetta Predictions human pricing
NM_012800 Rosetta Predictions rat pricing
NM_008772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334054 predicted 1213
2 SASI_Hs01_00242820 predicted 1539
3 SASI_Hs01_00242821 predicted 1613
4 SASI_Hs02_00334055 predicted 1552
5 SASI_Hs01_00242822 predicted 1737
6 SASI_Hs01_00242823 predicted 1722
7 SASI_Hs01_00242824 predicted 1755
8 SASI_Hs01_00242825 predicted 1438
9 SASI_Hs01_00242826 predicted 1052
10 SASI_Hs01_00242827 predicted 1708
11 SASI_Hs01_00242828 predicted 1609
12 SASI_Hs01_00242829 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091211 predicted 1684
2 SASI_Rn02_00260228 predicted 1252
3 SASI_Rn01_00091212 predicted 1539
4 SASI_Rn01_00091213 predicted 1519
5 SASI_Rn01_00091214 predicted 1652
6 SASI_Rn01_00091215 predicted 1322
7 SASI_Rn01_00091216 predicted 783
8 SASI_Rn01_00091217 predicted 1105
9 SASI_Rn01_00091218 predicted 1389
10 SASI_Rn01_00091219 predicted 1322
11 SASI_Rn01_00091210 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081711 predicted 1279
2 SASI_Mm01_00081712 predicted 1348
3 SASI_Mm01_00081713 predicted 1443
4 SASI_Mm01_00081714 predicted 1683
5 SASI_Mm01_00081715 predicted 1560
6 SASI_Mm01_00081716 predicted 1259
7 SASI_Mm01_00081717 predicted 1135
8 SASI_Mm02_00314663 predicted 1801
9 SASI_Mm01_00081718 predicted 1352
10 SASI_Mm01_00081719 predicted 1708
11 SASI_Mm01_00081720 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002563
P2RY1 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002563.2-2029s1c1
Sequence:CCGGCCCTCTTTAACTTTCTAGTTTCTCGAGAAACTAGAAAGTTAAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1725s1c1
Sequence:CCGGGCTTTCAATGACAGGGTTTATCTCGAGATAAACCCTGTCATTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1154s1c1
Sequence:CCGGCCTGATCTTCTACTACTTCAACTCGAGTTGAAGTAGTAGAAGATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1620s1c1
Sequence:CCGGGTAATCATTGTACTGACTGTTCTCGAGAACAGTCAGTACAATGATTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1000s1c1
Sequence:CCGGCGGCTGTCTACATCTTGGTATCTCGAGATACCAAGATGTAGACAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1609s21c1
Sequence:CCGGCGATTTACCTGGTAATCATTGCTCGAGCAATGATTACCAGGTAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1535s21c1
Sequence:CCGGTCTGGGCTGTTACGGATTAATCTCGAGATTAATCCGTAACAGCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1460s21c1
Sequence:CCGGCGAGTACCTGCGAAGTTATTTCTCGAGAAATAACTTCGCAGGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002563
P2RY1 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002563.2-2029s1c1
Sequence:CCGGCCCTCTTTAACTTTCTAGTTTCTCGAGAAACTAGAAAGTTAAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1725s1c1
Sequence:CCGGGCTTTCAATGACAGGGTTTATCTCGAGATAAACCCTGTCATTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1154s1c1
Sequence:CCGGCCTGATCTTCTACTACTTCAACTCGAGTTGAAGTAGTAGAAGATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1620s1c1
Sequence:CCGGGTAATCATTGTACTGACTGTTCTCGAGAACAGTCAGTACAATGATTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1000s1c1
Sequence:CCGGCGGCTGTCTACATCTTGGTATCTCGAGATACCAAGATGTAGACAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1609s21c1
Sequence:CCGGCGATTTACCTGGTAATCATTGCTCGAGCAATGATTACCAGGTAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1535s21c1
Sequence:CCGGTCTGGGCTGTTACGGATTAATCTCGAGATTAATCCGTAACAGCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1460s21c1
Sequence:CCGGCGAGTACCTGCGAAGTTATTTCTCGAGAAATAACTTCGCAGGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002563
P2RY1 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002563.2-2029s1c1
Sequence:CCGGCCCTCTTTAACTTTCTAGTTTCTCGAGAAACTAGAAAGTTAAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1725s1c1
Sequence:CCGGGCTTTCAATGACAGGGTTTATCTCGAGATAAACCCTGTCATTGAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1154s1c1
Sequence:CCGGCCTGATCTTCTACTACTTCAACTCGAGTTGAAGTAGTAGAAGATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1620s1c1
Sequence:CCGGGTAATCATTGTACTGACTGTTCTCGAGAACAGTCAGTACAATGATTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002563.2-1000s1c1
Sequence:CCGGCGGCTGTCTACATCTTGGTATCTCGAGATACCAAGATGTAGACAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1609s21c1
Sequence:CCGGCGATTTACCTGGTAATCATTGCTCGAGCAATGATTACCAGGTAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1535s21c1
Sequence:CCGGTCTGGGCTGTTACGGATTAATCTCGAGATTAATCCGTAACAGCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002563.2-1460s21c1
Sequence:CCGGCGAGTACCTGCGAAGTTATTTCTCGAGAAATAACTTCGCAGGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008772
VALIDATED
P2RY1 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1278s1c1
Sequence:CCGGCCTGCGAAGTTATTTCATCTACTCGAGTAGATGAAATAACTTCGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1707s1c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1265s1c1
Sequence:CCGGCGTCCAATGATTACCTGCGAACTCGAGTTCGCAGGTAATCATTGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1134s1c1
Sequence:CCGGGCTCAAGAAGAAGAATGCCATCTCGAGATGGCATTCTTCTTCTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1545s1c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1346s21c1
Sequence:CCGGCTTGGGCTGTTATGGATTAATCTCGAGATTAATCCATAACAGCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1955s21c1
Sequence:CCGGGTAAGATTTAGCGAGTCATTACTCGAGTAATGACTCGCTAAATCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1706s21c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1544s21c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008772
VALIDATED
P2RY1 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1278s1c1
Sequence:CCGGCCTGCGAAGTTATTTCATCTACTCGAGTAGATGAAATAACTTCGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1707s1c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1265s1c1
Sequence:CCGGCGTCCAATGATTACCTGCGAACTCGAGTTCGCAGGTAATCATTGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1134s1c1
Sequence:CCGGGCTCAAGAAGAAGAATGCCATCTCGAGATGGCATTCTTCTTCTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1545s1c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1346s21c1
Sequence:CCGGCTTGGGCTGTTATGGATTAATCTCGAGATTAATCCATAACAGCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1955s21c1
Sequence:CCGGGTAAGATTTAGCGAGTCATTACTCGAGTAATGACTCGCTAAATCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1706s21c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1544s21c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008772
VALIDATED
P2RY1 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1278s1c1
Sequence:CCGGCCTGCGAAGTTATTTCATCTACTCGAGTAGATGAAATAACTTCGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1707s1c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1265s1c1
Sequence:CCGGCGTCCAATGATTACCTGCGAACTCGAGTTCGCAGGTAATCATTGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1134s1c1
Sequence:CCGGGCTCAAGAAGAAGAATGCCATCTCGAGATGGCATTCTTCTTCTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008772.2-1545s1c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1346s21c1
Sequence:CCGGCTTGGGCTGTTATGGATTAATCTCGAGATTAATCCATAACAGCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1955s21c1
Sequence:CCGGGTAAGATTTAGCGAGTCATTACTCGAGTAATGACTCGCTAAATCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1706s21c1
Sequence:CCGGGAGTGAAGAAATGACTCTCAACTCGAGTTGAGAGTCATTTCTTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008772.4-1544s21c1
Sequence:CCGGCGACAGGGTTTATGCCACTTACTCGAGTAAGTGGCATAAACCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)