EMAIL THIS PAGE TO A FRIEND

P2RY2

purinergic receptor P2Y, G-protein coupled, 2

83 Gene Product Result for
Synonyms: HP2U P2RU1 P2U P2U1 P2UR P2Y2 P2Y2R
UniProtKB ID: P41231, B2R9W3, Q96EM8
Gene ID:
Human(5029) Summary: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]
Mouse(18442) purinergic receptor P2Y, G-protein coupled 2
Rat(29597) purinergic receptor P2Y, G-protein coupled, 2
domestic guinea pig(100730145) purinergic receptor P2Y, G-protein coupled, 2
naked mole-rat(101720626) purinergic receptor P2Y, G-protein coupled, 2
chicken(428108) purinergic receptor P2Y, G-protein coupled, 2
cow(282638) purinergic receptor P2Y, G-protein coupled, 2
Horse(100065753) purinergic receptor P2Y, G-protein coupled, 2
dog(485203) purinergic receptor P2Y, G-protein coupled, 2
domestic cat(101099323) purinergic receptor P2Y, G-protein coupled, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002564 Rosetta Predictions human pricing
NM_176071 Rosetta Predictions human pricing
NM_176072 Rosetta Predictions human pricing
NM_017255 Rosetta Predictions rat pricing
NM_008773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234389 predicted 1033
2 SASI_Hs01_00234390 predicted 1265
3 SASI_Hs01_00234391 predicted 621
4 SASI_Hs01_00234392 predicted 956
5 SASI_Hs01_00234393 predicted 1359
6 SASI_Hs01_00234394 predicted 1469
7 SASI_Hs01_00234395 predicted 1404
8 SASI_Hs01_00234396 predicted 1517
9 SASI_Hs01_00234397 predicted 986
10 SASI_Hs02_00334056 predicted 1430
11 SASI_Hs01_00234388 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212851 predicted 1095
2 SASI_Hs01_00212852 predicted 1327
3 SASI_Hs01_00212853 predicted 688
4 SASI_Hs01_00212854 predicted 1018
5 SASI_Hs01_00212855 predicted 1420
6 SASI_Hs01_00212856 predicted 1536
7 SASI_Hs01_00212857 predicted 1461
8 SASI_Hs01_00212858 predicted 1583
9 SASI_Hs01_00212859 predicted 1050
10 SASI_Hs02_00369194 predicted 1494
11 SASI_Hs01_00212850 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049535 predicted 1168
2 SASI_Hs01_00049536 predicted 1396
3 SASI_Hs01_00049537 predicted 761
4 SASI_Hs01_00049538 predicted 1089
5 SASI_Hs01_00049539 predicted 1487
6 SASI_Hs01_00049540 predicted 1607
7 SASI_Hs01_00049541 predicted 1538
8 SASI_Hs01_00049542 predicted 1647
9 SASI_Hs01_00049543 predicted 1121
10 SASI_Hs02_00369195 predicted 1558
11 SASI_Hs01_00049534 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053177 predicted 532
2 SASI_Rn01_00053178 predicted 1012
3 SASI_Rn01_00053180 predicted 1117
4 SASI_Rn01_00053182 predicted 792
5 SASI_Rn01_00053183 predicted 1692
6 SASI_Rn01_00053184 predicted 1377
7 SASI_Rn01_00053185 predicted 493
8 SASI_Rn01_00053186 predicted 1268
9 SASI_Rn02_00261645 predicted 703
10 SASI_Rn02_00261646 predicted 1290
11 SASI_Rn01_00053179 predicted 786
12 SASI_Rn01_00053181 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049683 predicted 1746
2 SASI_Mm01_00049684 predicted 1570
3 SASI_Mm01_00049685 predicted 1373
4 SASI_Mm01_00049686 predicted 1360
5 SASI_Mm01_00049687 predicted 1272
6 SASI_Mm01_00049688 predicted 1100
7 SASI_Mm01_00049689 predicted 770
8 SASI_Mm01_00049690 predicted 641
9 SASI_Mm01_00049691 predicted 530
10 SASI_Mm01_00049692 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176072
P2RY2 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1505s1c1
Sequence:CCGGGCAGAGGATAGAAGATGTGTTCTCGAGAACACATCTTCTATCCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1966s21c1
Sequence:CCGGTGGCTTACCAAGATCACATACCTCGAGGTATGTGATCTTGGTAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-693s1c1
Sequence:CCGGGCTGTGTCTGATGCACTGTATCTCGAGATACAGTGCATCAGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176072.1-2511s1c1
Sequence:CCGGGCCAGTCATGTGCTGGTAAATCTCGAGATTTACCAGCACATGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1613s21c1
Sequence:CCGGTTCAGCCTGTGCAGGTTTATACTCGAGTATAAACCTGCACAGGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1350s1c1
Sequence:CCGGGCCAGTGCTAACAGTTGCCTTCTCGAGAAGGCAACTGTTAGCACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1109s1c1
Sequence:CCGGCCTTGTCTGTTACGTGCTCATCTCGAGATGAGCACGTAACAGACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-1573s21c1
Sequence:CCGGGCGAGAACACTAAGGACATTCCTCGAGGAATGTCCTTAGTGTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-662s21c1
Sequence:CCGGGAATGCGTCCACCACATATATCTCGAGATATATGTGGTGGACGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176072
P2RY2 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1505s1c1
Sequence:CCGGGCAGAGGATAGAAGATGTGTTCTCGAGAACACATCTTCTATCCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1966s21c1
Sequence:CCGGTGGCTTACCAAGATCACATACCTCGAGGTATGTGATCTTGGTAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-693s1c1
Sequence:CCGGGCTGTGTCTGATGCACTGTATCTCGAGATACAGTGCATCAGACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176072.1-2511s1c1
Sequence:CCGGGCCAGTCATGTGCTGGTAAATCTCGAGATTTACCAGCACATGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1613s21c1
Sequence:CCGGTTCAGCCTGTGCAGGTTTATACTCGAGTATAAACCTGCACAGGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1350s1c1
Sequence:CCGGGCCAGTGCTAACAGTTGCCTTCTCGAGAAGGCAACTGTTAGCACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1109s1c1
Sequence:CCGGCCTTGTCTGTTACGTGCTCATCTCGAGATGAGCACGTAACAGACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-1573s21c1
Sequence:CCGGGCGAGAACACTAAGGACATTCCTCGAGGAATGTCCTTAGTGTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-662s21c1
Sequence:CCGGGAATGCGTCCACCACATATATCTCGAGATATATGTGGTGGACGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176072
P2RY2 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1505s1c1
Sequence:CCGGGCAGAGGATAGAAGATGTGTTCTCGAGAACACATCTTCTATCCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1966s21c1
Sequence:CCGGTGGCTTACCAAGATCACATACCTCGAGGTATGTGATCTTGGTAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-693s1c1
Sequence:CCGGGCTGTGTCTGATGCACTGTATCTCGAGATACAGTGCATCAGACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176072.1-2511s1c1
Sequence:CCGGGCCAGTCATGTGCTGGTAAATCTCGAGATTTACCAGCACATGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176072.1-1613s21c1
Sequence:CCGGTTCAGCCTGTGCAGGTTTATACTCGAGTATAAACCTGCACAGGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1350s1c1
Sequence:CCGGGCCAGTGCTAACAGTTGCCTTCTCGAGAAGGCAACTGTTAGCACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176072.1-1109s1c1
Sequence:CCGGCCTTGTCTGTTACGTGCTCATCTCGAGATGAGCACGTAACAGACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-1573s21c1
Sequence:CCGGGCGAGAACACTAAGGACATTCCTCGAGGAATGTCCTTAGTGTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176072.1-662s21c1
Sequence:CCGGGAATGCGTCCACCACATATATCTCGAGATATATGTGGTGGACGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008773
P2RY2 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-731s1c1
Sequence:CCGGCCTGCCGCTGTTGGTTTATTACTCGAGTAATAAACCAACAGCGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-548s1c1
Sequence:CCGGGTGTCGTTTCAACGAGGACTTCTCGAGAAGTCCTCGTTGAAACGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1496s1c1
Sequence:CCGGGCCTAACAGAACTGTGAGGAACTCGAGTTCCTCACAGTTCTGTTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1118s1c1
Sequence:CCGGCCTGGTCTGTTACGTGCTTATCTCGAGATAAGCACGTAACAGACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1322s1c1
Sequence:CCGGCGCCATCAACATGGCATATAACTCGAGTTATATGCCATGTTGATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008773
P2RY2 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-731s1c1
Sequence:CCGGCCTGCCGCTGTTGGTTTATTACTCGAGTAATAAACCAACAGCGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-548s1c1
Sequence:CCGGGTGTCGTTTCAACGAGGACTTCTCGAGAAGTCCTCGTTGAAACGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1496s1c1
Sequence:CCGGGCCTAACAGAACTGTGAGGAACTCGAGTTCCTCACAGTTCTGTTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1118s1c1
Sequence:CCGGCCTGGTCTGTTACGTGCTTATCTCGAGATAAGCACGTAACAGACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1322s1c1
Sequence:CCGGCGCCATCAACATGGCATATAACTCGAGTTATATGCCATGTTGATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008773
P2RY2 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-731s1c1
Sequence:CCGGCCTGCCGCTGTTGGTTTATTACTCGAGTAATAAACCAACAGCGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-548s1c1
Sequence:CCGGGTGTCGTTTCAACGAGGACTTCTCGAGAAGTCCTCGTTGAAACGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1496s1c1
Sequence:CCGGGCCTAACAGAACTGTGAGGAACTCGAGTTCCTCACAGTTCTGTTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1118s1c1
Sequence:CCGGCCTGGTCTGTTACGTGCTTATCTCGAGATAAGCACGTAACAGACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008773.2-1322s1c1
Sequence:CCGGCGCCATCAACATGGCATATAACTCGAGTTATATGCCATGTTGATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)