EMAIL THIS PAGE TO A FRIEND

P2RY6

pyrimidinergic receptor P2Y, G-protein coupled, 6

84 Gene Product Result for
Synonyms: P2Y6
UniProtKB ID: Q15077, Q15754
Gene ID:
Human(5031) Summary: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
Mouse(233571) pyrimidinergic receptor P2Y, G-protein coupled, 6
Rat(117264) pyrimidinergic receptor P2Y, G-protein coupled, 6
domestic guinea pig(100712612) pyrimidinergic receptor P2Y, G-protein coupled, 6
naked mole-rat(101719811) pyrimidinergic receptor P2Y, G-protein coupled, 6
sheep(101123660) pyrimidinergic receptor P2Y, G-protein coupled, 6
chicken(396114) pyrimidinergic receptor P2Y, G-protein coupled, 6
cow(539703) pyrimidinergic receptor P2Y, G-protein coupled, 6
domestic cat(101099073) pyrimidinergic receptor P2Y, G-protein coupled, 6
dog(485202) pyrimidinergic receptor P2Y, G-protein coupled, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900528 Anti-P2RY6 / P2Y6 antibody produced in rabbit affinity isolated antibody human, rat, rabbit, monkey, hamster, bovine, pig
immunohistochemistry pricing
P6622 Anti-Purinergic Receptor P2Y6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunohistochemistry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004154 Rosetta Predictions human pricing
NM_176796 Rosetta Predictions human pricing
NM_176797 Rosetta Predictions human pricing
NM_176798 Rosetta Predictions human pricing
NM_057124 Rosetta Predictions rat pricing
NM_183168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088464 predicted 1195
2 SASI_Hs01_00088465 predicted 482
3 SASI_Hs01_00088466 predicted 477
4 SASI_Hs01_00088468 predicted 1226
5 SASI_Hs01_00088469 predicted 542
6 SASI_Hs01_00088471 predicted 1232
7 SASI_Hs01_00088472 predicted 1201
8 SASI_Hs01_00088473 predicted 645
9 SASI_Hs02_00337005 predicted 560
10 SASI_Hs02_00337006 predicted 1151
11 SASI_Hs01_00088467 predicted 1311
12 SASI_Hs01_00088470 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224023 predicted 1293
2 SASI_Hs01_00224024 predicted 1227
3 SASI_Hs01_00224025 predicted 1237
4 SASI_Hs01_00224026 predicted 582
5 SASI_Hs01_00224027 predicted 588
6 SASI_Hs01_00224028 predicted 1215
7 SASI_Hs01_00224029 predicted 966
8 SASI_Hs01_00224030 predicted 1328
9 SASI_Hs01_00224031 predicted 966
10 SASI_Hs01_00224032 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084679 predicted 1134
2 SASI_Hs01_00084680 predicted 1074
3 SASI_Hs01_00084681 predicted 1074
4 SASI_Hs01_00084682 predicted 422
5 SASI_Hs01_00084683 predicted 428
6 SASI_Hs01_00084684 predicted 1056
7 SASI_Hs01_00084685 predicted 800
8 SASI_Hs01_00084686 predicted 1169
9 SASI_Hs01_00084687 predicted 806
10 SASI_Hs01_00084688 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031628 predicted 1432
2 SASI_Hs01_00031629 predicted 1367
3 SASI_Hs01_00031630 predicted 1365
4 SASI_Hs01_00031631 predicted 721
5 SASI_Hs01_00031632 predicted 727
6 SASI_Hs01_00031633 predicted 1353
7 SASI_Hs01_00031634 predicted 1101
8 SASI_Hs01_00031635 predicted 1466
9 SASI_Hs01_00031636 predicted 1109
10 SASI_Hs01_00031637 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075735 predicted 268
2 SASI_Rn01_00075736 predicted 937
3 SASI_Rn01_00075738 predicted 263
4 SASI_Rn02_00267068 predicted 1378
5 SASI_Rn01_00075739 predicted 1216
6 SASI_Rn01_00075740 predicted 220
7 SASI_Rn01_00075741 predicted 1389
8 SASI_Rn01_00075742 predicted 1256
9 SASI_Rn01_00075743 predicted 824
10 SASI_Rn02_00267069 predicted 1380
11 SASI_Rn01_00075737 predicted 1112
12 SASI_Rn01_00075744 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091911 predicted 441
2 SASI_Mm01_00091913 predicted 601
3 SASI_Mm01_00091915 predicted 1433
4 SASI_Mm01_00091916 predicted 1009
5 SASI_Mm01_00091918 predicted 1087
6 SASI_Mm01_00091919 predicted 993
7 SASI_Mm01_00091920 predicted 991
8 SASI_Mm02_00350258 predicted 515
9 SASI_Mm02_00350259 predicted 692
10 SASI_Mm02_00350260 predicted 749
11 SASI_Mm01_00091912 predicted 1288
12 SASI_Mm01_00091914 predicted 709
13 SASI_Mm01_00091917 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176797
P2RY6 MISSION shRNA Bacterial Glycerol Stock
pyrimidinergic receptor P2Y, G-protein coupled, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1244s21c1
Sequence:CCGGCCTGGGCAGCCTTCATATTTGCTCGAGCAAATATGAAGGCTGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176797.1-1249s1c1
Sequence:CCGGGCAGCCTTCATATTTGCCATTCTCGAGAATGGCAAATATGAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-377s1c1
Sequence:CCGGCATCTGTGTCATTACCCAGATCTCGAGATCTGGGTAATGACACAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-806s1c1
Sequence:CCGGCCACTATATGCCCTATGGCATCTCGAGATGCCATAGGGCATATAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1190s1c1
Sequence:CCGGCCTACAGAAACTCACAGCCAACTCGAGTTGGCTGTGAGTTTCTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1142s1c1
Sequence:CCGGCCTCTTCTACTTCACCCAGAACTCGAGTTCTGGGTGAAGTAGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1299s21c1
Sequence:CCGGCCCAAACCATGCGGAGAATTACTCGAGTAATTCTCCGCATGGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-547s21c1
Sequence:CCGGTGGTCCGCTTCCTCTTCTATGCTCGAGCATAGAAGAGGAAGCGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-451s21c1
Sequence:CCGGCTCTGGCTGACCTGCTATATGCTCGAGCATATAGCAGGTCAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176797
P2RY6 MISSION shRNA shRNA Plasmid DNA
pyrimidinergic receptor P2Y, G-protein coupled, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1244s21c1
Sequence:CCGGCCTGGGCAGCCTTCATATTTGCTCGAGCAAATATGAAGGCTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176797.1-1249s1c1
Sequence:CCGGGCAGCCTTCATATTTGCCATTCTCGAGAATGGCAAATATGAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-377s1c1
Sequence:CCGGCATCTGTGTCATTACCCAGATCTCGAGATCTGGGTAATGACACAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-806s1c1
Sequence:CCGGCCACTATATGCCCTATGGCATCTCGAGATGCCATAGGGCATATAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1190s1c1
Sequence:CCGGCCTACAGAAACTCACAGCCAACTCGAGTTGGCTGTGAGTTTCTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1142s1c1
Sequence:CCGGCCTCTTCTACTTCACCCAGAACTCGAGTTCTGGGTGAAGTAGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1299s21c1
Sequence:CCGGCCCAAACCATGCGGAGAATTACTCGAGTAATTCTCCGCATGGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-547s21c1
Sequence:CCGGTGGTCCGCTTCCTCTTCTATGCTCGAGCATAGAAGAGGAAGCGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-451s21c1
Sequence:CCGGCTCTGGCTGACCTGCTATATGCTCGAGCATATAGCAGGTCAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176797
P2RY6 MISSION shRNA Lentiviral Transduction Particles
pyrimidinergic receptor P2Y, G-protein coupled, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1244s21c1
Sequence:CCGGCCTGGGCAGCCTTCATATTTGCTCGAGCAAATATGAAGGCTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176797.1-1249s1c1
Sequence:CCGGGCAGCCTTCATATTTGCCATTCTCGAGAATGGCAAATATGAAGGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-377s1c1
Sequence:CCGGCATCTGTGTCATTACCCAGATCTCGAGATCTGGGTAATGACACAGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-806s1c1
Sequence:CCGGCCACTATATGCCCTATGGCATCTCGAGATGCCATAGGGCATATAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1190s1c1
Sequence:CCGGCCTACAGAAACTCACAGCCAACTCGAGTTGGCTGTGAGTTTCTGTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176797.1-1142s1c1
Sequence:CCGGCCTCTTCTACTTCACCCAGAACTCGAGTTCTGGGTGAAGTAGAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176797.1-1299s21c1
Sequence:CCGGCCCAAACCATGCGGAGAATTACTCGAGTAATTCTCCGCATGGTTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-547s21c1
Sequence:CCGGTGGTCCGCTTCCTCTTCTATGCTCGAGCATAGAAGAGGAAGCGGACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176797.1-451s21c1
Sequence:CCGGCTCTGGCTGACCTGCTATATGCTCGAGCATATAGCAGGTCAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183168
P2RY6 MISSION shRNA Bacterial Glycerol Stock
pyrimidinergic receptor P2Y, G-protein coupled, 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1011s1c1
Sequence:CCGGCATAGCCTTACTGGCTTGTTACTCGAGTAACAAGCCAGTAAGGCTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183168.1-1503s1c1
Sequence:CCGGCCTCCAGAATTTCCACATCAACTCGAGTTGATGTGGAAATTCTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-703s1c1
Sequence:CCGGCGCTTCCTCTTCTATGCCAATCTCGAGATTGGCATAGAAGAGGAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1164s1c1
Sequence:CCGGCATCACCAAGACAGCCTACTTCTCGAGAAGTAGGCTGTCTTGGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-525s21c1
Sequence:CCGGCACTGAACATCTGCGTCATTGCTCGAGCAATGACGCAGATGTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1592s21c1
Sequence:CCGGAGGATGTTGTGACAAGATAACCTCGAGGTTATCTTGTCACAACATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-639s21c1
Sequence:CCGGCCCTACTTATCTATAACTACGCTCGAGCGTAGTTATAGATAAGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1548s21c1
Sequence:CCGGTGATTTGGCAACTGGTCAATTCTCGAGAATTGACCAGTTGCCAAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183168
P2RY6 MISSION shRNA shRNA Plasmid DNA
pyrimidinergic receptor P2Y, G-protein coupled, 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1011s1c1
Sequence:CCGGCATAGCCTTACTGGCTTGTTACTCGAGTAACAAGCCAGTAAGGCTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183168.1-1503s1c1
Sequence:CCGGCCTCCAGAATTTCCACATCAACTCGAGTTGATGTGGAAATTCTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-703s1c1
Sequence:CCGGCGCTTCCTCTTCTATGCCAATCTCGAGATTGGCATAGAAGAGGAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1164s1c1
Sequence:CCGGCATCACCAAGACAGCCTACTTCTCGAGAAGTAGGCTGTCTTGGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-525s21c1
Sequence:CCGGCACTGAACATCTGCGTCATTGCTCGAGCAATGACGCAGATGTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1592s21c1
Sequence:CCGGAGGATGTTGTGACAAGATAACCTCGAGGTTATCTTGTCACAACATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-639s21c1
Sequence:CCGGCCCTACTTATCTATAACTACGCTCGAGCGTAGTTATAGATAAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1548s21c1
Sequence:CCGGTGATTTGGCAACTGGTCAATTCTCGAGAATTGACCAGTTGCCAAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183168
P2RY6 MISSION shRNA Lentiviral Transduction Particles
pyrimidinergic receptor P2Y, G-protein coupled, 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1011s1c1
Sequence:CCGGCATAGCCTTACTGGCTTGTTACTCGAGTAACAAGCCAGTAAGGCTATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183168.1-1503s1c1
Sequence:CCGGCCTCCAGAATTTCCACATCAACTCGAGTTGATGTGGAAATTCTGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-703s1c1
Sequence:CCGGCGCTTCCTCTTCTATGCCAATCTCGAGATTGGCATAGAAGAGGAAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183168.1-1164s1c1
Sequence:CCGGCATCACCAAGACAGCCTACTTCTCGAGAAGTAGGCTGTCTTGGTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-525s21c1
Sequence:CCGGCACTGAACATCTGCGTCATTGCTCGAGCAATGACGCAGATGTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1592s21c1
Sequence:CCGGAGGATGTTGTGACAAGATAACCTCGAGGTTATCTTGTCACAACATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183168.2-639s21c1
Sequence:CCGGCCCTACTTATCTATAACTACGCTCGAGCGTAGTTATAGATAAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183168.2-1548s21c1
Sequence:CCGGTGATTTGGCAACTGGTCAATTCTCGAGAATTGACCAGTTGCCAAATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)