EMAIL THIS PAGE TO A FRIEND

P2RY8

purinergic receptor P2Y, G-protein coupled, 8

24 Gene Product Result for
Synonyms: P2Y8
UniProtKB ID: Q86VZ1
Gene ID:
Human(286530) Summary: The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene is moderately expressed in undifferentiated HL60 cells, and is located on both chromosomes X and Y. [provided by RefSeq, Jul 2008]
chicken(418665) purinergic receptor P2Y, G-protein coupled, 8
cow(100299937) purinergic receptor P2Y, G-protein coupled, 8
dog(491711) purinergic receptor P2Y, G-protein coupled, 8
sheep(101114246) purinergic receptor P2Y, G-protein coupled, 8
naked mole-rat(101697089) purinergic receptor P2Y, G-protein coupled, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178129 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007151 MISSION® esiRNA esiRNA targeting human P2RY8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178129 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101405 predicted 235
2 SASI_Hs01_00101406 predicted 1071
3 SASI_Hs01_00101408 predicted 980
4 SASI_Hs01_00101409 predicted 934
5 SASI_Hs01_00101410 predicted 425
6 SASI_Hs01_00101411 predicted 777
7 SASI_Hs01_00101412 predicted 1066
8 SASI_Hs01_00101413 predicted 771
9 SASI_Hs02_00369539 predicted 427
10 SASI_Hs01_00101414 predicted 729
11 SASI_Hs01_00101407 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178129
P2RY8 MISSION shRNA Bacterial Glycerol Stock
purinergic receptor P2Y, G-protein coupled, 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1558s21c1
Sequence:CCGGAGCGCACAGGGTGCTTGTTATCTCGAGATAACAAGCACCCTGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-579s21c1
Sequence:CCGGATCCTCACCATGACCTGTATCCTCGAGGATACAGGTCATGGTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1710s21c1
Sequence:CCGGCATACCCGAGGGTGGATATTCCTCGAGGAATATCCACCCTCGGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-523s1c1
Sequence:CCGGCGCAAACATGTATTCCAGCATCTCGAGATGCTGGAATACATGTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178129.3-3221s1c1
Sequence:CCGGGCTGGATTATTAAGCACCCTACTCGAGTAGGGTGCTTAATAATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-1015s1c1
Sequence:CCGGCAAGAGCTACTACCACGTGTACTCGAGTACACGTGGTAGTAGCTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-433s1c1
Sequence:CCGGCGTGTTGCCTTTCCAAATCTACTCGAGTAGATTTGGAAAGGCAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-1102s21c1
Sequence:CCGGACAACTGTCTGGACCCGTTTGCTCGAGCAAACGGGTCCAGACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-440s1c1
Sequence:CCGGCCTTTCCAAATCTACTACCATCTCGAGATGGTAGTAGATTTGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178129
P2RY8 MISSION shRNA shRNA Plasmid DNA
purinergic receptor P2Y, G-protein coupled, 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1558s21c1
Sequence:CCGGAGCGCACAGGGTGCTTGTTATCTCGAGATAACAAGCACCCTGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-579s21c1
Sequence:CCGGATCCTCACCATGACCTGTATCCTCGAGGATACAGGTCATGGTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1710s21c1
Sequence:CCGGCATACCCGAGGGTGGATATTCCTCGAGGAATATCCACCCTCGGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-523s1c1
Sequence:CCGGCGCAAACATGTATTCCAGCATCTCGAGATGCTGGAATACATGTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178129.3-3221s1c1
Sequence:CCGGGCTGGATTATTAAGCACCCTACTCGAGTAGGGTGCTTAATAATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-1015s1c1
Sequence:CCGGCAAGAGCTACTACCACGTGTACTCGAGTACACGTGGTAGTAGCTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-433s1c1
Sequence:CCGGCGTGTTGCCTTTCCAAATCTACTCGAGTAGATTTGGAAAGGCAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-1102s21c1
Sequence:CCGGACAACTGTCTGGACCCGTTTGCTCGAGCAAACGGGTCCAGACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-440s1c1
Sequence:CCGGCCTTTCCAAATCTACTACCATCTCGAGATGGTAGTAGATTTGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178129
P2RY8 MISSION shRNA Lentiviral Transduction Particles
purinergic receptor P2Y, G-protein coupled, 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1558s21c1
Sequence:CCGGAGCGCACAGGGTGCTTGTTATCTCGAGATAACAAGCACCCTGTGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-579s21c1
Sequence:CCGGATCCTCACCATGACCTGTATCCTCGAGGATACAGGTCATGGTGAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178129.4-1710s21c1
Sequence:CCGGCATACCCGAGGGTGGATATTCCTCGAGGAATATCCACCCTCGGGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-523s1c1
Sequence:CCGGCGCAAACATGTATTCCAGCATCTCGAGATGCTGGAATACATGTTTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178129.3-3221s1c1
Sequence:CCGGGCTGGATTATTAAGCACCCTACTCGAGTAGGGTGCTTAATAATCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-1015s1c1
Sequence:CCGGCAAGAGCTACTACCACGTGTACTCGAGTACACGTGGTAGTAGCTCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-433s1c1
Sequence:CCGGCGTGTTGCCTTTCCAAATCTACTCGAGTAGATTTGGAAAGGCAACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178129.4-1102s21c1
Sequence:CCGGACAACTGTCTGGACCCGTTTGCTCGAGCAAACGGGTCCAGACAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178129.3-440s1c1
Sequence:CCGGCCTTTCCAAATCTACTACCATCTCGAGATGGTAGTAGATTTGGAAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)