EMAIL THIS PAGE TO A FRIEND

P4HA1

prolyl 4-hydroxylase, alpha polypeptide I

71 Gene Product Result for
Synonyms: P4HA
UniProtKB ID: P13674, C9JL12, Q15082, Q15083, Q5VSQ5
Gene ID:
Human(5033) Summary: This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(18451) procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
Rat(64475) prolyl 4-hydroxylase, alpha polypeptide I
chicken(423704) prolyl 4-hydroxylase, alpha polypeptide I
cow(518288) prolyl 4-hydroxylase, alpha polypeptide I
domestic cat(101096846) prolyl 4-hydroxylase, alpha polypeptide I
dog(479242) prolyl 4-hydroxylase, alpha polypeptide I
Domestic Rabbit(100340270) prolyl 4-hydroxylase, alpha polypeptide I
naked mole-rat(101702867) prolyl 4-hydroxylase, alpha polypeptide I
domestic guinea pig(100716746) prolyl 4-hydroxylase, alpha polypeptide I
sheep(101116374) prolyl 4-hydroxylase, alpha polypeptide I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000917 Rosetta Predictions human pricing
NM_001017962 Rosetta Predictions human pricing
NM_172062 Rosetta Predictions rat pricing
NM_011030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303490 predicted 523
2 SASI_Hs01_00128550 predicted 308
3 SASI_Hs01_00128551 predicted 665
4 SASI_Hs01_00128552 predicted 901
5 SASI_Hs01_00128553 predicted 1810
6 SASI_Hs01_00128555 predicted 688
7 SASI_Hs02_00303491 predicted 1763
8 SASI_Hs02_00303492 predicted 319
9 SASI_Hs01_00128556 predicted 719
10 SASI_Hs01_00128557 predicted 578
11 SASI_Hs01_00128548 predicted 446
12 SASI_Hs01_00128549 predicted 1807
13 SASI_Hs01_00128554 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306821 predicted 521
2 SASI_Hs01_00048952 predicted 308
3 SASI_Hs01_00048953 predicted 664
4 SASI_Hs01_00048954 predicted 901
5 SASI_Hs01_00048955 predicted 1809
6 SASI_Hs01_00048957 predicted 688
7 SASI_Hs02_00306822 predicted 1760
8 SASI_Hs02_00306823 predicted 326
9 SASI_Hs01_00048958 predicted 722
10 SASI_Hs01_00048959 predicted 578
11 SASI_Hs01_00048950 predicted 456
12 SASI_Hs01_00048951 predicted 1801
13 SASI_Hs01_00048956 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043644 predicted 689
2 SASI_Rn01_00043645 predicted 1354
3 SASI_Rn02_00269164 predicted 740
4 SASI_Rn01_00043646 predicted 1883
5 SASI_Rn01_00043647 predicted 752
6 SASI_Rn01_00043648 predicted 1467
7 SASI_Rn01_00043649 predicted 827
8 SASI_Rn01_00043650 predicted 318
9 SASI_Rn01_00043651 predicted 1766
10 SASI_Rn01_00043652 predicted 472
11 SASI_Rn01_00043653 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104119 predicted 1362
2 SASI_Mm01_00104120 predicted 1782
3 SASI_Mm01_00104121 predicted 659
4 SASI_Mm01_00104122 predicted 649
5 SASI_Mm01_00104123 predicted 806
6 SASI_Mm01_00104124 predicted 1652
7 SASI_Mm01_00104125 predicted 215
8 SASI_Mm01_00104126 predicted 848
9 SASI_Mm01_00104127 predicted 1179
10 SASI_Mm01_00104128 predicted 1804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011030
VALIDATED
P4HA1 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-368s1c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011030.1-2684s1c1
Sequence:CCGGCCCGTTCTAATTTACTTCTTTCTCGAGAAAGAAGTAAATTAGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1714s1c1
Sequence:CCGGGCACCCTGTCAGAATTGGAATCTCGAGATTCCAATTCTGACAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011030.1-663s1c1
Sequence:CCGGGCAGATTATTACCACACAGAACTCGAGTTCTGTGTGGTAATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-729s21c1
Sequence:CCGGCCTATACAGAGGCAGATTATTCTCGAGAATAATCTGCCTCTGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1219s1c1
Sequence:CCGGCCACCATTTCAAACCCAGTAACTCGAGTTACTGGGTTTGAAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011030.2-2301s21c1
Sequence:CCGGCGTGCAGAGTTCCTATTATTTCTCGAGAAATAATAGGAACTCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-445s21c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-929s21c1
Sequence:CCGGGCTAATGGTAACTTAGTATATCTCGAGATATACTAAGTTACCATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-1381s21c1
Sequence:CCGGCCCTGTGGTATCCCGAATTAACTCGAGTTAATTCGGGATACCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011030
VALIDATED
P4HA1 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-368s1c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011030.1-2684s1c1
Sequence:CCGGCCCGTTCTAATTTACTTCTTTCTCGAGAAAGAAGTAAATTAGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1714s1c1
Sequence:CCGGGCACCCTGTCAGAATTGGAATCTCGAGATTCCAATTCTGACAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011030.1-663s1c1
Sequence:CCGGGCAGATTATTACCACACAGAACTCGAGTTCTGTGTGGTAATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-729s21c1
Sequence:CCGGCCTATACAGAGGCAGATTATTCTCGAGAATAATCTGCCTCTGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1219s1c1
Sequence:CCGGCCACCATTTCAAACCCAGTAACTCGAGTTACTGGGTTTGAAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011030.2-2301s21c1
Sequence:CCGGCGTGCAGAGTTCCTATTATTTCTCGAGAAATAATAGGAACTCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-445s21c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-929s21c1
Sequence:CCGGGCTAATGGTAACTTAGTATATCTCGAGATATACTAAGTTACCATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-1381s21c1
Sequence:CCGGCCCTGTGGTATCCCGAATTAACTCGAGTTAATTCGGGATACCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011030
VALIDATED
P4HA1 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-368s1c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011030.1-2684s1c1
Sequence:CCGGCCCGTTCTAATTTACTTCTTTCTCGAGAAAGAAGTAAATTAGAACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1714s1c1
Sequence:CCGGGCACCCTGTCAGAATTGGAATCTCGAGATTCCAATTCTGACAGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011030.1-663s1c1
Sequence:CCGGGCAGATTATTACCACACAGAACTCGAGTTCTGTGTGGTAATAATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-729s21c1
Sequence:CCGGCCTATACAGAGGCAGATTATTCTCGAGAATAATCTGCCTCTGTATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011030.1-1219s1c1
Sequence:CCGGCCACCATTTCAAACCCAGTAACTCGAGTTACTGGGTTTGAAATGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011030.2-2301s21c1
Sequence:CCGGCGTGCAGAGTTCCTATTATTTCTCGAGAAATAATAGGAACTCTGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-445s21c1
Sequence:CCGGGCATCCTGTAAACGCATTCAACTCGAGTTGAATGCGTTTACAGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-929s21c1
Sequence:CCGGGCTAATGGTAACTTAGTATATCTCGAGATATACTAAGTTACCATTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011030.2-1381s21c1
Sequence:CCGGCCCTGTGGTATCCCGAATTAACTCGAGTTAATTCGGGATACCACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000917
VALIDATED
P4HA1 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-2022s21c1
Sequence:CCGGAGTAACACGAAATCATCATATCTCGAGATATGATGATTTCGTGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-708s1c1
Sequence:CCGGGCGAGATTTCTACCATAGATACTCGAGTATCTATGGTAGAAATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-1121s1c1
Sequence:CCGGCCTCGTATTATTCGCTTCCATCTCGAGATGGAAGCGAATAATACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1587s1c1
Sequence:CCGGCCAGTGGAGAAGGAGATTATACTCGAGTATAATCTCCTTCTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1628s1c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-296s1c1
Sequence:CCGGGCAGAGAAGTTAGATCGGCTACTCGAGTAGCCGATCTAACTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-1751s21c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-763s21c1
Sequence:CCGGCTATACAGAAGCAGATTATTACTCGAGTAATAATCTGCTTCTGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-870s21c1
Sequence:CCGGATTTGAGCTATGCGGTATATCCTCGAGGATATACCGCATAGCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-1415s21c1
Sequence:CCGGCCTGTGGTGTCTCGAATTAATCTCGAGATTAATTCGAGACACCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000917
VALIDATED
P4HA1 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-2022s21c1
Sequence:CCGGAGTAACACGAAATCATCATATCTCGAGATATGATGATTTCGTGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-708s1c1
Sequence:CCGGGCGAGATTTCTACCATAGATACTCGAGTATCTATGGTAGAAATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-1121s1c1
Sequence:CCGGCCTCGTATTATTCGCTTCCATCTCGAGATGGAAGCGAATAATACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1587s1c1
Sequence:CCGGCCAGTGGAGAAGGAGATTATACTCGAGTATAATCTCCTTCTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1628s1c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-296s1c1
Sequence:CCGGGCAGAGAAGTTAGATCGGCTACTCGAGTAGCCGATCTAACTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-1751s21c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-763s21c1
Sequence:CCGGCTATACAGAAGCAGATTATTACTCGAGTAATAATCTGCTTCTGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-870s21c1
Sequence:CCGGATTTGAGCTATGCGGTATATCCTCGAGGATATACCGCATAGCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-1415s21c1
Sequence:CCGGCCTGTGGTGTCTCGAATTAATCTCGAGATTAATTCGAGACACCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000917
VALIDATED
P4HA1 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-2022s21c1
Sequence:CCGGAGTAACACGAAATCATCATATCTCGAGATATGATGATTTCGTGTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-708s1c1
Sequence:CCGGGCGAGATTTCTACCATAGATACTCGAGTATCTATGGTAGAAATCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-1121s1c1
Sequence:CCGGCCTCGTATTATTCGCTTCCATCTCGAGATGGAAGCGAATAATACGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1587s1c1
Sequence:CCGGCCAGTGGAGAAGGAGATTATACTCGAGTATAATCTCCTTCTCCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000917.1-1628s1c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000917.1-296s1c1
Sequence:CCGGGCAGAGAAGTTAGATCGGCTACTCGAGTAGCCGATCTAACTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-1751s21c1
Sequence:CCGGCCAGTGCTAGTTGGCAACAAACTCGAGTTTGTTGCCAACTAGCACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000917.3-763s21c1
Sequence:CCGGCTATACAGAAGCAGATTATTACTCGAGTAATAATCTGCTTCTGTATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-870s21c1
Sequence:CCGGATTTGAGCTATGCGGTATATCCTCGAGGATATACCGCATAGCTCAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000917.3-1415s21c1
Sequence:CCGGCCTGTGGTGTCTCGAATTAATCTCGAGATTAATTCGAGACACCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)