EMAIL THIS PAGE TO A FRIEND

P4HA2

prolyl 4-hydroxylase, alpha polypeptide II

89 Gene Product Result for
UniProtKB ID: O15460, D3DQ85, D3DQ86, Q8WWN0
Gene ID:
Human(8974) Summary: This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(18452) procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
Rat(360526) prolyl 4-hydroxylase, alpha polypeptide II
Zebrafish(373132) procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide 2
cow(507327) prolyl 4-hydroxylase, alpha polypeptide II
domestic cat(101094394) prolyl 4-hydroxylase, alpha polypeptide II
dog(474672) prolyl 4-hydroxylase, alpha polypeptide II
chicken(416326) prolyl 4-hydroxylase, alpha polypeptide II
domestic guinea pig(100718564) prolyl 4-hydroxylase, alpha polypeptide II
naked mole-rat(101724121) prolyl 4-hydroxylase, alpha polypeptide II
Domestic Rabbit(100328721) prolyl 4-hydroxylase, alpha polypeptide II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017973 Rosetta Predictions human pricing
NM_001017974 Rosetta Predictions human pricing
NM_004199 Rosetta Predictions human pricing
NM_001108275 Rosetta Predictions rat pricing
NM_011031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069712 predicted 1355
2 SASI_Hs01_00069713 predicted 804
3 SASI_Hs01_00069714 predicted 2212
4 SASI_Hs01_00069716 predicted 1305
5 SASI_Hs02_00306850 predicted 2237
6 SASI_Hs01_00069718 predicted 773
7 SASI_Hs01_00069719 predicted 1581
8 SASI_Hs01_00069720 predicted 2221
9 SASI_Hs01_00069721 predicted 931
10 SASI_Hs02_00306851 predicted 820
11 SASI_Hs01_00069715 predicted 971
12 SASI_Hs01_00069717 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017804 predicted 880
2 SASI_Hs01_00017805 predicted 338
3 SASI_Hs01_00017806 predicted 1749
4 SASI_Hs01_00017808 predicted 832
5 SASI_Hs02_00306852 predicted 1765
6 SASI_Hs01_00017810 predicted 298
7 SASI_Hs01_00017811 predicted 1110
8 SASI_Hs01_00017812 predicted 1755
9 SASI_Hs01_00017813 predicted 460
10 SASI_Hs02_00306853 predicted 348
11 SASI_Hs01_00017807 predicted 496
12 SASI_Hs01_00017809 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218962 predicted 1350
2 SASI_Hs01_00218963 predicted 809
3 SASI_Hs01_00218964 predicted 2222
4 SASI_Hs01_00218966 predicted 1306
5 SASI_Hs02_00337096 predicted 2245
6 SASI_Hs01_00218968 predicted 769
7 SASI_Hs01_00218969 predicted 1576
8 SASI_Hs01_00218970 predicted 2225
9 SASI_Hs01_00218971 predicted 932
10 SASI_Hs02_00337097 predicted 823
11 SASI_Hs01_00218965 predicted 968
12 SASI_Hs01_00218967 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237054 predicted 1265
2 SASI_Rn02_00237055 predicted 1321
3 SASI_Rn02_00237056 predicted 1499
4 SASI_Rn02_00237057 predicted 1697
5 SASI_Rn02_00237058 predicted 787
6 SASI_Rn02_00237059 predicted 342
7 SASI_Rn02_00237060 predicted 1325
8 SASI_Rn02_00237061 predicted 1001
9 SASI_Rn02_00237062 predicted 1016
10 SASI_Rn02_00237063 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038812 predicted 1155
2 SASI_Mm01_00038813 predicted 1440
3 SASI_Mm01_00038814 predicted 572
4 SASI_Mm01_00038815 predicted 1749
5 SASI_Mm01_00038816 predicted 1462
6 SASI_Mm01_00038817 predicted 1394
7 SASI_Mm01_00038818 predicted 1208
8 SASI_Mm01_00038819 predicted 1583
9 SASI_Mm01_00038820 predicted 1631
10 SASI_Mm01_00038821 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004199
VALIDATED
P4HA2 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide II
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1578s21c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1879s21c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1502s1c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1201s1c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-310s1c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-687s21c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-248s1c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-625s21c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004199
VALIDATED
P4HA2 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide II
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1578s21c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1879s21c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1502s1c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1201s1c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-310s1c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-687s21c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-248s1c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-625s21c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004199
VALIDATED
P4HA2 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide II
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1578s21c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-1879s21c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1502s1c1
Sequence:CCGGCGAGATACTTTCAAGCATTTACTCGAGTAAATGCTTGAAAGTATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-1201s1c1
Sequence:CCGGCGTCAGGTACTACGATGTCATCTCGAGATGACATCGTAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-310s1c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-687s21c1
Sequence:CCGGGCAGTCTCTGAAAGAGTACATCTCGAGATGTACTCTTTCAGAGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004199.1-248s1c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004199.2-625s21c1
Sequence:CCGGGCCGAATTCTTCACCTCTATTCTCGAGAATAGAGGTGAAGAATTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011031
VALIDATED
P4HA2 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide II
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-362s21c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1283s21c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1010s21c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-249s1c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1800s1c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-897s1c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1170s1c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-898s1c1
Sequence:CCGGCGGTACTTTGAACGGTTGTTACTCGAGTAACAACCGTTCAAAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011031.2-1913s21c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011031
VALIDATED
P4HA2 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide II
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-362s21c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1283s21c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1010s21c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-249s1c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1800s1c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-897s1c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1170s1c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-898s1c1
Sequence:CCGGCGGTACTTTGAACGGTTGTTACTCGAGTAACAACCGTTCAAAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011031.2-1913s21c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011031
VALIDATED
P4HA2 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide II
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-362s21c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1283s21c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011031.2-1010s21c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-249s1c1
Sequence:CCGGCGATCTGATTTACGCAGAGAACTCGAGTTCTCTGCGTAAATCAGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1800s1c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-897s1c1
Sequence:CCGGGCGGTACTTTGAACGGTTGTTCTCGAGAACAACCGTTCAAAGTACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-1170s1c1
Sequence:CCGGCGTCAGGTACTATGATGTGATCTCGAGATCACATCATAGTACCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011031.1-898s1c1
Sequence:CCGGCGGTACTTTGAACGGTTGTTACTCGAGTAACAACCGTTCAAAGTACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011031.2-1913s21c1
Sequence:CCGGCCAAATCATCTTCAAGTTCAACTCGAGTTGAACTTGAAGATGATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)