EMAIL THIS PAGE TO A FRIEND

P4HA3

prolyl 4-hydroxylase, alpha polypeptide III

59 Gene Product Result for
UniProtKB ID: Q7Z4N8, A0AV13, Q5EBL3, Q5JPA9
Gene ID:
Human(283208) Summary: This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(320452) procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Rat(361612) prolyl 4-hydroxylase, alpha polypeptide III
Zebrafish(563281) prolyl 4-hydroxylase, alpha polypeptide III
chicken(419057) prolyl 4-hydroxylase, alpha polypeptide III
domestic cat(101081160) prolyl 4-hydroxylase, alpha polypeptide III
cow(414348) prolyl 4-hydroxylase, alpha polypeptide III
dog(609381) prolyl 4-hydroxylase, alpha polypeptide III
naked mole-rat(101711128) prolyl 4-hydroxylase, alpha polypeptide III
domestic guinea pig(100735153) prolyl 4-hydroxylase, alpha polypeptide III
sheep(101104856) prolyl 4-hydroxylase, alpha polypeptide III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002811 MISSION® esiRNA esiRNA targeting mouse P4ha3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182904 Rosetta Predictions human pricing
NM_198775 Rosetta Predictions rat pricing
XM_001066817 Rosetta Predictions rat pricing
NM_177161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206434 predicted 469
2 SASI_Hs01_00206435 predicted 829
3 SASI_Hs01_00206436 predicted 1342
4 SASI_Hs01_00206437 predicted 1360
5 SASI_Hs01_00206438 predicted 831
6 SASI_Hs01_00206439 predicted 229
7 SASI_Hs01_00206440 predicted 727
8 SASI_Hs01_00206441 predicted 745
9 SASI_Hs01_00206442 predicted 1414
10 SASI_Hs01_00206443 predicted 1710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036613 predicted 726
2 SASI_Rn01_00036614 predicted 1286
3 SASI_Rn01_00036615 predicted 782
4 SASI_Rn01_00036616 predicted 281
5 SASI_Rn01_00036617 predicted 725
6 SASI_Rn01_00036618 predicted 813
7 SASI_Rn01_00036619 predicted 811
8 SASI_Rn01_00036620 predicted 217
9 SASI_Rn01_00036621 predicted 982
10 SASI_Rn01_00036622 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318784 predicted 641
2 SASI_Rn02_00318785 predicted 1195
3 SASI_Rn02_00318786 predicted 1492
4 SASI_Rn02_00318787 predicted 691
5 SASI_Rn02_00318788 predicted 1545
6 SASI_Rn02_00318789 predicted 623
7 SASI_Rn02_00318790 predicted 259
8 SASI_Rn02_00318791 predicted 721
9 SASI_Rn02_00318792 predicted 366
10 SASI_Rn02_00318793 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039608 predicted 254
2 SASI_Mm01_00039609 predicted 1274
3 SASI_Mm01_00039610 predicted 334
4 SASI_Mm01_00039611 predicted 764
5 SASI_Mm01_00039612 predicted 1309
6 SASI_Mm01_00039613 predicted 706
7 SASI_Mm01_00039614 predicted 356
8 SASI_Mm01_00039615 predicted 963
9 SASI_Mm01_00039616 predicted 204
10 SASI_Mm01_00039617 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177161
P4HA3 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide III
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-251s1c1
Sequence:CCGGCCTGTAGTGAATCCTCTACTTCTCGAGAAGTAGAGGATTCACTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-207s1c1
Sequence:CCGGGATTCTATGACAAGGTACTTTCTCGAGAAAGTACCTTGTCATAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-766s1c1
Sequence:CCGGCCTTGTCTACAGCCCAGACAACTCGAGTTGTCTGGGCTGTAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-937s1c1
Sequence:CCGGCCAGCCAACACACTACCAAATCTCGAGATTTGGTAGTGTGTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-1285s1c1
Sequence:CCGGCCAGGTGGTGAACTATGGAATCTCGAGATTCCATAGTTCACCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177161
P4HA3 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide III
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-251s1c1
Sequence:CCGGCCTGTAGTGAATCCTCTACTTCTCGAGAAGTAGAGGATTCACTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-207s1c1
Sequence:CCGGGATTCTATGACAAGGTACTTTCTCGAGAAAGTACCTTGTCATAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-766s1c1
Sequence:CCGGCCTTGTCTACAGCCCAGACAACTCGAGTTGTCTGGGCTGTAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-937s1c1
Sequence:CCGGCCAGCCAACACACTACCAAATCTCGAGATTTGGTAGTGTGTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-1285s1c1
Sequence:CCGGCCAGGTGGTGAACTATGGAATCTCGAGATTCCATAGTTCACCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177161
P4HA3 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide III
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-251s1c1
Sequence:CCGGCCTGTAGTGAATCCTCTACTTCTCGAGAAGTAGAGGATTCACTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-207s1c1
Sequence:CCGGGATTCTATGACAAGGTACTTTCTCGAGAAAGTACCTTGTCATAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-766s1c1
Sequence:CCGGCCTTGTCTACAGCCCAGACAACTCGAGTTGTCTGGGCTGTAGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-937s1c1
Sequence:CCGGCCAGCCAACACACTACCAAATCTCGAGATTTGGTAGTGTGTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177161.3-1285s1c1
Sequence:CCGGCCAGGTGGTGAACTATGGAATCTCGAGATTCCATAGTTCACCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182904
P4HA3 MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, alpha polypeptide III
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-833s1c1
Sequence:CCGGGCCAGGAATGTCTTGAAATATCTCGAGATATTTCAAGACATTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-304s1c1
Sequence:CCGGGCTTGCATTTACTCTCATCAACTCGAGTTGATGAGAGTAAATGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-1607s1c1
Sequence:CCGGGTGGCCAACAAGTGGATACATCTCGAGATGTATCCACTTGTTGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-995s1c1
Sequence:CCGGCCTAGCCTCTACTGTTCCTATCTCGAGATAGGAACAGTAGAGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-235s1c1
Sequence:CCGGCCTGACTAGATTCTACGACAACTCGAGTTGTCGTAGAATCTAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-737s21c1
Sequence:CCGGCACTTGGCCTTTGCTTATTTCCTCGAGGAAATAAGCAAAGGCCAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-668s21c1
Sequence:CCGGAGTCTCTTCCGAGGATCTTACCTCGAGGTAAGATCCTCGGAAGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182904.3-1818s21c1
Sequence:CCGGAGGCAAGGGAGAGGTTGTTACCTCGAGGTAACAACCTCTCCCTTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182904
P4HA3 MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, alpha polypeptide III
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-833s1c1
Sequence:CCGGGCCAGGAATGTCTTGAAATATCTCGAGATATTTCAAGACATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-304s1c1
Sequence:CCGGGCTTGCATTTACTCTCATCAACTCGAGTTGATGAGAGTAAATGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-1607s1c1
Sequence:CCGGGTGGCCAACAAGTGGATACATCTCGAGATGTATCCACTTGTTGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-995s1c1
Sequence:CCGGCCTAGCCTCTACTGTTCCTATCTCGAGATAGGAACAGTAGAGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-235s1c1
Sequence:CCGGCCTGACTAGATTCTACGACAACTCGAGTTGTCGTAGAATCTAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-737s21c1
Sequence:CCGGCACTTGGCCTTTGCTTATTTCCTCGAGGAAATAAGCAAAGGCCAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-668s21c1
Sequence:CCGGAGTCTCTTCCGAGGATCTTACCTCGAGGTAAGATCCTCGGAAGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182904.3-1818s21c1
Sequence:CCGGAGGCAAGGGAGAGGTTGTTACCTCGAGGTAACAACCTCTCCCTTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182904
P4HA3 MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, alpha polypeptide III
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-833s1c1
Sequence:CCGGGCCAGGAATGTCTTGAAATATCTCGAGATATTTCAAGACATTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-304s1c1
Sequence:CCGGGCTTGCATTTACTCTCATCAACTCGAGTTGATGAGAGTAAATGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-1607s1c1
Sequence:CCGGGTGGCCAACAAGTGGATACATCTCGAGATGTATCCACTTGTTGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-995s1c1
Sequence:CCGGCCTAGCCTCTACTGTTCCTATCTCGAGATAGGAACAGTAGAGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182904.2-235s1c1
Sequence:CCGGCCTGACTAGATTCTACGACAACTCGAGTTGTCGTAGAATCTAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-737s21c1
Sequence:CCGGCACTTGGCCTTTGCTTATTTCCTCGAGGAAATAAGCAAAGGCCAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182904.3-668s21c1
Sequence:CCGGAGTCTCTTCCGAGGATCTTACCTCGAGGTAAGATCCTCGGAAGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182904.3-1818s21c1
Sequence:CCGGAGGCAAGGGAGAGGTTGTTACCTCGAGGTAACAACCTCTCCCTTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)