EMAIL THIS PAGE TO A FRIEND

P4HB

prolyl 4-hydroxylase, beta polypeptide

61 Gene Product Result for
Synonyms: DSI ERBA2L GIT P4Hbeta PDI PDIA1 PHDB PO4DB PO4HB PROHB
UniProtKB ID: P07237, B2RDQ2, P30037, P32079, Q15205, Q6LDE5
Gene ID:
Human(5034) Summary: This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]
Mouse(18453) prolyl 4-hydroxylase, beta polypeptide
Rat(25506) prolyl 4-hydroxylase, beta polypeptide
sheep(101115218) prolyl 4-hydroxylase, beta polypeptide
sheep(100135700) prolyl 4-hydroxylase, beta polypeptide
domestic guinea pig(100733944) prolyl 4-hydroxylase, beta polypeptide
naked mole-rat(101712215) prolyl 4-hydroxylase, beta polypeptide
Domestic Rabbit(100328595) prolyl 4-hydroxylase, beta polypeptide
Zebrafish(406673) procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide
cow(281373) prolyl 4-hydroxylase, beta polypeptide
domestic cat(101099917) prolyl 4-hydroxylase, beta polypeptide
dog(483369) prolyl 4-hydroxylase, beta polypeptide
chicken(374091) prolyl 4-hydroxylase, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48150 Anti-P4HB (AB1) antibody produced in rabbit affinity isolated antibody human, rat, horse, rabbit, mouse, bovine
immunohistochemistry, western blot pricing
AV48151 Anti-P4HB (AB2) antibody produced in rabbit affinity isolated antibody pig, bovine, human, mouse, rat, rabbit, horse, dog
immunohistochemistry, western blot pricing
SAB1406213 Anti-P4HB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA018884 Anti-P4HB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
P7122 Anti-Protein Disulfide Isomerase (DL-11) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
P7372 Anti-Protein Disulfide Isomerase (MD-12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution bovine, mouse, human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
P7496 Anti-Protein Disulfide Isomerase antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, bovine, rat, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000918 Rosetta Predictions human pricing
NM_012998 Rosetta Predictions rat pricing
NM_011032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094811 predicted 763
2 SASI_Hs01_00094812 predicted 978
3 SASI_Hs01_00094813 predicted 1034
4 SASI_Hs02_00303493 predicted 1051
5 SASI_Hs02_00303494 predicted 658
6 SASI_Hs01_00094814 predicted 938
7 SASI_Hs01_00094815 predicted 738
8 SASI_Hs01_00094816 predicted 1836
9 SASI_Hs01_00094817 predicted 1003
10 SASI_Hs01_00094818 predicted 736
11 SASI_Hs01_00094819 predicted 512
12 SASI_Hs01_00094820 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082185 predicted 1283
2 SASI_Rn01_00082186 predicted 262
3 SASI_Rn01_00082187 predicted 412
4 SASI_Rn02_00260648 predicted 1370
5 SASI_Rn01_00082188 predicted 1149
6 SASI_Rn02_00260649 predicted 883
7 SASI_Rn01_00082190 predicted 1390
8 SASI_Rn01_00082192 predicted 599
9 SASI_Rn01_00082193 predicted 1373
10 SASI_Rn01_00082194 predicted 1477
11 SASI_Rn01_00082189 predicted 351
12 SASI_Rn01_00082191 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180628 predicted 1477
2 SASI_Mm01_00180629 predicted 1463
3 SASI_Mm01_00180631 predicted 538
4 SASI_Mm01_00180632 predicted 665
5 SASI_Mm01_00180633 predicted 1079
6 SASI_Mm01_00180635 predicted 1637
7 SASI_Mm01_00180636 predicted 783
8 SASI_Mm01_00180637 predicted 1111
9 SASI_Mm02_00319765 predicted 1094
10 SASI_Mm02_00319766 predicted 361
11 SASI_Mm01_00180630 predicted 770
12 SASI_Mm01_00180634 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011032
P4HB MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-661s1c1
Sequence:CCGGGCAGAGGCTATTGATGACATACTCGAGTATGTCATCAATAGCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-919s1c1
Sequence:CCGGCCCAAGAGTGTATCTGACTATCTCGAGATAGTCAGATACACTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011032.1-2016s1c1
Sequence:CCGGGCATTTCATCTGTGAGGCATTCTCGAGAATGCCTCACAGATGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-356s1c1
Sequence:CCGGGCTCTGAGATTCGACTAGCAACTCGAGTTGCTAGTCGAATCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-1030s1c1
Sequence:CCGGCAGCGCATACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTATGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011032
P4HB MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-661s1c1
Sequence:CCGGGCAGAGGCTATTGATGACATACTCGAGTATGTCATCAATAGCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-919s1c1
Sequence:CCGGCCCAAGAGTGTATCTGACTATCTCGAGATAGTCAGATACACTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011032.1-2016s1c1
Sequence:CCGGGCATTTCATCTGTGAGGCATTCTCGAGAATGCCTCACAGATGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-356s1c1
Sequence:CCGGGCTCTGAGATTCGACTAGCAACTCGAGTTGCTAGTCGAATCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-1030s1c1
Sequence:CCGGCAGCGCATACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTATGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011032
P4HB MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, beta polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-661s1c1
Sequence:CCGGGCAGAGGCTATTGATGACATACTCGAGTATGTCATCAATAGCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-919s1c1
Sequence:CCGGCCCAAGAGTGTATCTGACTATCTCGAGATAGTCAGATACACTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011032.1-2016s1c1
Sequence:CCGGGCATTTCATCTGTGAGGCATTCTCGAGAATGCCTCACAGATGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-356s1c1
Sequence:CCGGGCTCTGAGATTCGACTAGCAACTCGAGTTGCTAGTCGAATCTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011032.1-1030s1c1
Sequence:CCGGCAGCGCATACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTATGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000918
VALIDATED
P4HB MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-950s1c1
Sequence:CCGGCGAGTTCTTTGGCCTGAAGAACTCGAGTTCTTCAGGCCAAAGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1232s1c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-382s1c1
Sequence:CCGGCCAAGGAATATACAGCTGGCACTCGAGTGCCAGCTGTATATTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1015s1c1
Sequence:CCGGTGACCAAGTACAAGCCCGAATCTCGAGATTCGGGCTTGTACTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000918.2-1394s1c1
Sequence:CCGGCGACAGGACGGTCATTGATTACTCGAGTAATCAATGACCGTCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000918.3-1407s21c1
Sequence:CCGGGCTCCCATTTGGGATAAACTGCTCGAGCAGTTTATCCCAAATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-1385s21c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-970s21c1
Sequence:CCGGTGCTGTTCTTGCCCAAGAGTGCTCGAGCACTCTTGGGCAAGAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-947s21c1
Sequence:CCGGAGGTGAAATCAAGACTCACATCTCGAGATGTGAGTCTTGATTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000918
VALIDATED
P4HB MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-950s1c1
Sequence:CCGGCGAGTTCTTTGGCCTGAAGAACTCGAGTTCTTCAGGCCAAAGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1232s1c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-382s1c1
Sequence:CCGGCCAAGGAATATACAGCTGGCACTCGAGTGCCAGCTGTATATTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1015s1c1
Sequence:CCGGTGACCAAGTACAAGCCCGAATCTCGAGATTCGGGCTTGTACTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000918.2-1394s1c1
Sequence:CCGGCGACAGGACGGTCATTGATTACTCGAGTAATCAATGACCGTCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000918.3-1407s21c1
Sequence:CCGGGCTCCCATTTGGGATAAACTGCTCGAGCAGTTTATCCCAAATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-1385s21c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-970s21c1
Sequence:CCGGTGCTGTTCTTGCCCAAGAGTGCTCGAGCACTCTTGGGCAAGAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-947s21c1
Sequence:CCGGAGGTGAAATCAAGACTCACATCTCGAGATGTGAGTCTTGATTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000918
VALIDATED
P4HB MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-950s1c1
Sequence:CCGGCGAGTTCTTTGGCCTGAAGAACTCGAGTTCTTCAGGCCAAAGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1232s1c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-382s1c1
Sequence:CCGGCCAAGGAATATACAGCTGGCACTCGAGTGCCAGCTGTATATTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000918.2-1015s1c1
Sequence:CCGGTGACCAAGTACAAGCCCGAATCTCGAGATTCGGGCTTGTACTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000918.2-1394s1c1
Sequence:CCGGCGACAGGACGGTCATTGATTACTCGAGTAATCAATGACCGTCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000918.3-1407s21c1
Sequence:CCGGGCTCCCATTTGGGATAAACTGCTCGAGCAGTTTATCCCAAATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-1385s21c1
Sequence:CCGGGTGTGGTCACTGCAAACAGTTCTCGAGAACTGTTTGCAGTGACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-970s21c1
Sequence:CCGGTGCTGTTCTTGCCCAAGAGTGCTCGAGCACTCTTGGGCAAGAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000918.3-947s21c1
Sequence:CCGGAGGTGAAATCAAGACTCACATCTCGAGATGTGAGTCTTGATTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)