EMAIL THIS PAGE TO A FRIEND

PA2G4

proliferation-associated 2G4, 38kDa

131 Gene Product Result for
Synonyms: EBP1 HG4-1 p38-2G4
UniProtKB ID: Q9UQ80, O43846, Q9UM59
Gene ID:
Human(5036) Summary: This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]
Mouse(18813) proliferation-associated 2G4
Rat(288778) proliferation-associated 2G4
chicken(425279) proliferation-associated 2G4, 38kDa
dog(474396) proliferation-associated 2G4, 38kDa
domestic cat(101095110) proliferation-associated 2G4, 38kDa
cow(540272) proliferation-associated 2G4, 38kDa
Horse(100051912) proliferation-associated 2G4, 38kDa
sheep(101111702) proliferation-associated 2G4, 38kDa
domestic guinea pig(100712672) proliferation-associated 2G4, 38kDa
naked mole-rat(101720506) proliferation-associated 2G4, 38kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306698 ANTI-EBP1 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
GW22060F Anti-EBP1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
AV47601 Anti-PA2G4 (AB1) antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, dog, human, mouse, horse, bovine
immunohistochemistry, western blot pricing
AV47602 Anti-PA2G4 (AB2) antibody produced in rabbit IgG fraction of antiserum dog, rat, bovine, horse, mouse, rabbit, guinea pig, human
western blot pricing
SAB1406214 Anti-PA2G4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA016484 Anti-PA2G4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2101707 Anti-PA2G4 antibody produced in rabbit affinity isolated antibody human, mouse, horse, rat, guinea pig, rabbit, bovine, dog
immunohistochemistry, western blot pricing
SAB2107306 Anti-PA2G4 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, mouse, dog, bovine, human, rat
western blot pricing
SAB1402863 Monoclonal Anti-PA2G4, (N-terminal) antibody produced in mouse clone 2A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006191 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006191 Rosetta Predictions human pricing
NM_001004206 Rosetta Predictions rat pricing
NM_011119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022791 predicted 1062
2 SASI_Hs02_00341071 predicted 1043
3 SASI_Hs01_00022792 predicted 959
4 SASI_Hs01_00022794 predicted 885
5 SASI_Hs01_00022795 predicted 1246
6 SASI_Hs02_00341072 predicted 547
7 SASI_Hs01_00022797 predicted 653
8 SASI_Hs01_00022798 predicted 561
9 SASI_Hs01_00022799 predicted 936
10 SASI_Hs01_00022800 predicted 1148
11 SASI_Hs01_00022793 predicted 851
12 SASI_Hs01_00022796 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036783 predicted 939
2 SASI_Rn01_00036784 predicted 660
3 SASI_Rn01_00036785 predicted 222
4 SASI_Rn01_00036786 predicted 948
5 SASI_Rn01_00036787 predicted 1065
6 SASI_Rn01_00036788 predicted 541
7 SASI_Rn01_00036789 predicted 1110
8 SASI_Rn01_00036790 predicted 1129
9 SASI_Rn01_00036791 predicted 1058
10 SASI_Rn01_00036792 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038662 predicted 829
2 SASI_Mm01_00038663 predicted 645
3 SASI_Mm01_00038664 predicted 688
4 SASI_Mm01_00038665 predicted 610
5 SASI_Mm01_00038666 predicted 315
6 SASI_Mm01_00038667 predicted 934
7 SASI_Mm01_00038668 predicted 753
8 SASI_Mm01_00038669 predicted 633
9 SASI_Mm01_00038670 predicted 403
10 SASI_Mm01_00038671 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006191
VALIDATED
PA2G4 MISSION shRNA Bacterial Glycerol Stock
proliferation-associated 2G4, 38kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-327s1c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-142s1c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-1003s1c1
Sequence:CCGGGCAACCATTTAATGTTCTCTACTCGAGTAGAGAACATTAAATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-1139s21c1
Sequence:CCGGAGGACAGAGAACCACTATTTACTCGAGTAAATAGTGGTTCTCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-451s1c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-464s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-379s1c1
Sequence:CCGGCGACCAGGATTATATTCTCAACTCGAGTTGAGAATATAATCCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006191.2-1937s21c1
Sequence:CCGGACTACAGAACAGGGCTAAATTCTCGAGAATTTAGCCCTGTTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-773s21c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-649s21c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006191
VALIDATED
PA2G4 MISSION shRNA shRNA Plasmid DNA
proliferation-associated 2G4, 38kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-327s1c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-142s1c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-1003s1c1
Sequence:CCGGGCAACCATTTAATGTTCTCTACTCGAGTAGAGAACATTAAATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-1139s21c1
Sequence:CCGGAGGACAGAGAACCACTATTTACTCGAGTAAATAGTGGTTCTCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-451s1c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-464s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-379s1c1
Sequence:CCGGCGACCAGGATTATATTCTCAACTCGAGTTGAGAATATAATCCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006191.2-1937s21c1
Sequence:CCGGACTACAGAACAGGGCTAAATTCTCGAGAATTTAGCCCTGTTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-773s21c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-649s21c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006191
VALIDATED
PA2G4 MISSION shRNA Lentiviral Transduction Particles
proliferation-associated 2G4, 38kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-327s1c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-142s1c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-1003s1c1
Sequence:CCGGGCAACCATTTAATGTTCTCTACTCGAGTAGAGAACATTAAATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-1139s21c1
Sequence:CCGGAGGACAGAGAACCACTATTTACTCGAGTAAATAGTGGTTCTCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-451s1c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-464s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006191.1-379s1c1
Sequence:CCGGCGACCAGGATTATATTCTCAACTCGAGTTGAGAATATAATCCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006191.2-1937s21c1
Sequence:CCGGACTACAGAACAGGGCTAAATTCTCGAGAATTTAGCCCTGTTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-773s21c1
Sequence:CCGGCGCTAATGTAGCTCACACTTTCTCGAGAAAGTGTGAGCTACATTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006191.2-649s21c1
Sequence:CCGGCCACCAGCATTTCGGTAAATACTCGAGTATTTACCGAAATGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011119
VALIDATED
PA2G4 MISSION shRNA Bacterial Glycerol Stock
proliferation-associated 2G4, 38kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1094s1c1
Sequence:CCGGGCCGTTTACTTTAAGAGCATTCTCGAGAATGCTCTTAAAGTAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-495s1c1
Sequence:CCGGCCTACCAGCATTTCCGTAAATCTCGAGATTTACGGAAATGCTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1215s1c1
Sequence:CCGGGCCCAGTTTAAATTTACAGTTCTCGAGAACTGTAAATTTAAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1527s1c1
Sequence:CCGGCGTCTTCTCCACCCAAGACTACTCGAGTAGTCTTGGGTGGAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-337s21c1
Sequence:CCGGCTACCAGCATTTCCGTAAATACTCGAGTATTTACGGAAATGCTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1161s1c1
Sequence:CCGGCATGAGTTACTACAGCCATTTCTCGAGAAATGGCTGTAGTAACTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-152s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-692s21c1
Sequence:CCGGTGATGGAGAGAAGACGATTATCTCGAGATAATCGTCTTCTCTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-759s21c1
Sequence:CCGGTTTGAGGTGCATGAGGTTTATCTCGAGATAAACCTCATGCACCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011119.3-1742s21c1
Sequence:CCGGCCTATCTGTCATCAAGTATTTCTCGAGAAATACTTGATGACAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011119
VALIDATED
PA2G4 MISSION shRNA shRNA Plasmid DNA
proliferation-associated 2G4, 38kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1094s1c1
Sequence:CCGGGCCGTTTACTTTAAGAGCATTCTCGAGAATGCTCTTAAAGTAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-495s1c1
Sequence:CCGGCCTACCAGCATTTCCGTAAATCTCGAGATTTACGGAAATGCTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1215s1c1
Sequence:CCGGGCCCAGTTTAAATTTACAGTTCTCGAGAACTGTAAATTTAAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1527s1c1
Sequence:CCGGCGTCTTCTCCACCCAAGACTACTCGAGTAGTCTTGGGTGGAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-337s21c1
Sequence:CCGGCTACCAGCATTTCCGTAAATACTCGAGTATTTACGGAAATGCTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1161s1c1
Sequence:CCGGCATGAGTTACTACAGCCATTTCTCGAGAAATGGCTGTAGTAACTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-152s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-692s21c1
Sequence:CCGGTGATGGAGAGAAGACGATTATCTCGAGATAATCGTCTTCTCTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-759s21c1
Sequence:CCGGTTTGAGGTGCATGAGGTTTATCTCGAGATAAACCTCATGCACCTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011119.3-1742s21c1
Sequence:CCGGCCTATCTGTCATCAAGTATTTCTCGAGAAATACTTGATGACAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011119
VALIDATED
PA2G4 MISSION shRNA Lentiviral Transduction Particles
proliferation-associated 2G4, 38kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1094s1c1
Sequence:CCGGGCCGTTTACTTTAAGAGCATTCTCGAGAATGCTCTTAAAGTAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-495s1c1
Sequence:CCGGCCTACCAGCATTTCCGTAAATCTCGAGATTTACGGAAATGCTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1215s1c1
Sequence:CCGGGCCCAGTTTAAATTTACAGTTCTCGAGAACTGTAAATTTAAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1527s1c1
Sequence:CCGGCGTCTTCTCCACCCAAGACTACTCGAGTAGTCTTGGGTGGAGAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-337s21c1
Sequence:CCGGCTACCAGCATTTCCGTAAATACTCGAGTATTTACGGAAATGCTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011119.1-1161s1c1
Sequence:CCGGCATGAGTTACTACAGCCATTTCTCGAGAAATGGCTGTAGTAACTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-152s21c1
Sequence:CCGGCCTGGTCGTGACCAAGTATAACTCGAGTTATACTTGGTCACGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-692s21c1
Sequence:CCGGTGATGGAGAGAAGACGATTATCTCGAGATAATCGTCTTCTCTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011119.3-759s21c1
Sequence:CCGGTTTGAGGTGCATGAGGTTTATCTCGAGATAAACCTCATGCACCTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011119.3-1742s21c1
Sequence:CCGGCCTATCTGTCATCAAGTATTTCTCGAGAAATACTTGATGACAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)