EMAIL THIS PAGE TO A FRIEND

PAAF1

proteasomal ATPase-associated factor 1

30 Gene Product Result for
Synonyms: PAAF Rpn14 WDR71
Gene ID:
Human(80227) Summary: This gene encodes a WD repeat-containing protein involved in regulation of association of proteasome components. During HIV infection, the encoded protein is thought to promote provirus transcription through recruitment of the 19S regulatory complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
chicken(419061) proteasomal ATPase-associated factor 1
dog(476810) proteasomal ATPase-associated factor 1
domestic cat(101096348) proteasomal ATPase-associated factor 1
cow(533348) proteasomal ATPase-associated factor 1
Horse(100052271) proteasomal ATPase-associated factor 1
naked mole-rat(101715672) proteasomal ATPase-associated factor 1
domestic guinea pig(100727827) proteasomal ATPase-associated factor 1
sheep(101104425) proteasomal ATPase-associated factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025155 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057501 MISSION® esiRNA esiRNA human PAAF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025155 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070813 predicted 1246
2 SASI_Hs01_00070814 predicted 1247
3 SASI_Hs01_00070815 predicted 679
4 SASI_Hs01_00070816 predicted 926
5 SASI_Hs01_00070817 predicted 525
6 SASI_Hs01_00070818 predicted 1250
7 SASI_Hs01_00070819 predicted 987
8 SASI_Hs01_00070820 predicted 1214
9 SASI_Hs01_00070821 predicted 357
10 SASI_Hs01_00070822 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025155
VALIDATED
PAAF1 MISSION shRNA Bacterial Glycerol Stock
proteasomal ATPase-associated factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1414s21c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1074s21c1
Sequence:CCGGTCCAGCAAGACTTAGACTATGCTCGAGCATAGTCTAAGTCTTGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-187s21c1
Sequence:CCGGTACAGCTTCAGAAGGATTTACCTCGAGGTAAATCCTTCTGAAGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-622s21c1
Sequence:CCGGAGATGGGACAGCACGACTTTGCTCGAGCAAAGTCGTGCTGTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-681s21c1
Sequence:CCGGATTGTGGTTCTTCTATCAATGCTCGAGCATTGATAGAAGAACCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025155.1-1270s1c1
Sequence:CCGGGCAGAAACATCATCAGTCCTTCTCGAGAAGGACTGATGATGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1414s1c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-719s1c1
Sequence:CCGGGCTGACAACTCCATAAACCTTCTCGAGAAGGTTTATGGAGTTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-119s1c1
Sequence:CCGGCCAGGGAAACCATCTTTGTATCTCGAGATACAAAGATGGTTTCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-550s1c1
Sequence:CCGGCAAAGGTCACAAAGGAGGTATCTCGAGATACCTCCTTTGTGACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1018s1c1
Sequence:CCGGGCTAAGTGTCAGAGATGGATTCTCGAGAATCCATCTCTGACACTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025155
VALIDATED
PAAF1 MISSION shRNA shRNA Plasmid DNA
proteasomal ATPase-associated factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1414s21c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1074s21c1
Sequence:CCGGTCCAGCAAGACTTAGACTATGCTCGAGCATAGTCTAAGTCTTGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-187s21c1
Sequence:CCGGTACAGCTTCAGAAGGATTTACCTCGAGGTAAATCCTTCTGAAGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-622s21c1
Sequence:CCGGAGATGGGACAGCACGACTTTGCTCGAGCAAAGTCGTGCTGTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-681s21c1
Sequence:CCGGATTGTGGTTCTTCTATCAATGCTCGAGCATTGATAGAAGAACCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025155.1-1270s1c1
Sequence:CCGGGCAGAAACATCATCAGTCCTTCTCGAGAAGGACTGATGATGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1414s1c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-719s1c1
Sequence:CCGGGCTGACAACTCCATAAACCTTCTCGAGAAGGTTTATGGAGTTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-119s1c1
Sequence:CCGGCCAGGGAAACCATCTTTGTATCTCGAGATACAAAGATGGTTTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-550s1c1
Sequence:CCGGCAAAGGTCACAAAGGAGGTATCTCGAGATACCTCCTTTGTGACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1018s1c1
Sequence:CCGGGCTAAGTGTCAGAGATGGATTCTCGAGAATCCATCTCTGACACTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025155
VALIDATED
PAAF1 MISSION shRNA Lentiviral Transduction Particles
proteasomal ATPase-associated factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1414s21c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-1074s21c1
Sequence:CCGGTCCAGCAAGACTTAGACTATGCTCGAGCATAGTCTAAGTCTTGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-187s21c1
Sequence:CCGGTACAGCTTCAGAAGGATTTACCTCGAGGTAAATCCTTCTGAAGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-622s21c1
Sequence:CCGGAGATGGGACAGCACGACTTTGCTCGAGCAAAGTCGTGCTGTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025155.1-681s21c1
Sequence:CCGGATTGTGGTTCTTCTATCAATGCTCGAGCATTGATAGAAGAACCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025155.1-1270s1c1
Sequence:CCGGGCAGAAACATCATCAGTCCTTCTCGAGAAGGACTGATGATGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1414s1c1
Sequence:CCGGCCACTGCATTTGTTCCAACTTCTCGAGAAGTTGGAACAAATGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-719s1c1
Sequence:CCGGGCTGACAACTCCATAAACCTTCTCGAGAAGGTTTATGGAGTTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-119s1c1
Sequence:CCGGCCAGGGAAACCATCTTTGTATCTCGAGATACAAAGATGGTTTCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025155.1-550s1c1
Sequence:CCGGCAAAGGTCACAAAGGAGGTATCTCGAGATACCTCCTTTGTGACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025155.1-1018s1c1
Sequence:CCGGGCTAAGTGTCAGAGATGGATTCTCGAGAATCCATCTCTGACACTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)