EMAIL THIS PAGE TO A FRIEND

PABPC1

poly(A) binding protein, cytoplasmic 1

37 Gene Product Result for
Synonyms: PAB1 PABP PABP1 PABPC2 PABPL1
UniProtKB ID: P11940, Q15097, Q93004
Gene ID:
Human(26986) Summary: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Mouse(18458) poly(A) binding protein, cytoplasmic 1
Rat(171350) poly(A) binding protein, cytoplasmic 1
chicken(430997) poly(A) binding protein, cytoplasmic 1
cow(282296) poly(A) binding protein, cytoplasmic 1
dog(612751) poly(A) binding protein, cytoplasmic 1
Horse(100056021) poly(A) binding protein, cytoplasmic 1
domestic cat(101083238) poly(A) binding protein, cytoplasmic 1
sheep(100135436) poly(A) binding protein, cytoplasmic 1
domestic guinea pig(100727743) poly(A) binding protein, cytoplasmic 1
naked mole-rat(101721124) poly(A) binding protein, cytoplasmic 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108698 Anti-PABPC1 affinity isolated antibody bovine, rabbit, human, sheep, rat, dog, horse, mouse, guinea pig
immunohistochemistry, western blot pricing
SAB2101708 Anti-PABPC1 antibody produced in rabbit affinity isolated antibody mouse, bovine, sheep, human, rat, rabbit, canine, guinea pig, horse
western blot pricing
SAB1410526 Anti-PABPC1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA045423 Anti-PABPC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA067156 Anti-PABPC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
P6246 Monoclonal Anti-PABP antibody produced in mouse clone 10E10, purified immunoglobulin, buffered aqueous solution canine, monkey, Xenopus, bovine, hamster, human
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002568 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021471 MISSION® esiRNA esiRNA targeting mouse Pabpc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002568 Rosetta Predictions human pricing
NM_134353 Rosetta Predictions rat pricing
NM_008774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134498 predicted 1715
2 SASI_Hs01_00134496 predicted 875
3 SASI_Hs01_00134497 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033999 predicted 1231
2 SASI_Rn01_00034000 predicted 847
3 SASI_Rn01_00034001 predicted 848
4 SASI_Rn01_00034002 predicted 801
5 SASI_Rn01_00034003 predicted 847
6 SASI_Rn01_00034004 predicted 825
7 SASI_Rn01_00034006 predicted 574
8 SASI_Rn02_00267908 predicted 1102
9 SASI_Rn02_00267909 predicted 666
10 SASI_Rn02_00267910 predicted 1144
11 SASI_Rn01_00033998 predicted 759
12 SASI_Rn01_00034005 predicted 758
13 SASI_Rn01_00034007 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314664 predicted 777
2 SASI_Mm01_00180001 predicted 1097
3 SASI_Mm01_00180002 predicted 1098
4 SASI_Mm01_00180003 predicted 1403
5 SASI_Mm01_00180006 predicted 1053
6 SASI_Mm01_00180007 predicted 769
7 SASI_Mm02_00314665 predicted 831
8 SASI_Mm01_00180008 predicted 1491
9 SASI_Mm01_00180009 predicted 1148
10 SASI_Mm01_00180010 predicted 1673
11 SASI_Mm01_00180004 predicted 2046
12 SASI_Mm01_00180005 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008774
VALIDATED
PABPC1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-783s1c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-1730s1c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-656s21c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008774.2-1146s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-2063s1c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-656s1c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-2063s21c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-783s21c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-1730s21c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008774
VALIDATED
PABPC1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-783s1c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-1730s1c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-656s21c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008774.2-1146s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-2063s1c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-656s1c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-2063s21c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-783s21c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-1730s21c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008774
VALIDATED
PABPC1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-783s1c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-1730s1c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-656s21c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008774.2-1146s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-2063s1c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008774.2-656s1c1
Sequence:CCGGCGTGCTTTGGACACCATGAATCTCGAGATTCATGGTGTCCAAAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-2063s21c1
Sequence:CCGGGCTGTTCATGTGCAAGGTCAACTCGAGTTGACCTTGCACATGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-783s21c1
Sequence:CCGGCCATCGACAATAAAGCACTATCTCGAGATAGTGCTTTATTGTCGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008774.2-1730s21c1
Sequence:CCGGCCTAGCCAAATTGCTCAACTACTCGAGTAGTTGAGCAATTTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002568
VALIDATED
PABPC1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1674s21c1
Sequence:CCGGAGCTGTTCCCAACCCTGTAATCTCGAGATTACAGGGTTGGGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2019s1c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-2019s21c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-822s21c1
Sequence:CCGGGGACAAATCCATTGATAATAACTCGAGTTATTATCAATGGATTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002568.3-2579s1c1
Sequence:CCGGGCAAACATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2021s1c1
Sequence:CCGGGCACCGTTCCACAGTATAAATCTCGAGATTTATACTGTGGAACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002568.3-1001s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACGATCTCGAGATCGTCCAACAAATACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-1829s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1829s21c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002568.3-1883s21c1
Sequence:CCGGGACCACCATTTAGTACTATGACTCGAGTCATAGTACTAAATGGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002568
VALIDATED
PABPC1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1674s21c1
Sequence:CCGGAGCTGTTCCCAACCCTGTAATCTCGAGATTACAGGGTTGGGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2019s1c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-2019s21c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-822s21c1
Sequence:CCGGGGACAAATCCATTGATAATAACTCGAGTTATTATCAATGGATTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002568.3-2579s1c1
Sequence:CCGGGCAAACATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2021s1c1
Sequence:CCGGGCACCGTTCCACAGTATAAATCTCGAGATTTATACTGTGGAACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002568.3-1001s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACGATCTCGAGATCGTCCAACAAATACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-1829s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1829s21c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002568.3-1883s21c1
Sequence:CCGGGACCACCATTTAGTACTATGACTCGAGTCATAGTACTAAATGGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002568
VALIDATED
PABPC1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1674s21c1
Sequence:CCGGAGCTGTTCCCAACCCTGTAATCTCGAGATTACAGGGTTGGGAACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2019s1c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-2019s21c1
Sequence:CCGGCCGCACCGTTCCACAGTATAACTCGAGTTATACTGTGGAACGGTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-822s21c1
Sequence:CCGGGGACAAATCCATTGATAATAACTCGAGTTATTATCAATGGATTTGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002568.3-2579s1c1
Sequence:CCGGGCAAACATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATGTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-2021s1c1
Sequence:CCGGGCACCGTTCCACAGTATAAATCTCGAGATTTATACTGTGGAACGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002568.3-1001s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACGATCTCGAGATCGTCCAACAAATACTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002568.3-1829s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002568.3-1829s21c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002568.3-1883s21c1
Sequence:CCGGGACCACCATTTAGTACTATGACTCGAGTCATAGTACTAAATGGTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)