EMAIL THIS PAGE TO A FRIEND

PABPC1L2A

poly(A) binding protein, cytoplasmic 1-like 2A

34 Gene Product Result for
Synonyms: RBM32A
UniProtKB ID: Q5JQF8, B2RMV9, Q8IVU8
Gene ID:
Rat(302405) poly(A) binding protein, cytoplasmic 1-like 2A
sheep(101111256) poly(A) binding protein, cytoplasmic 1-like 2A
cow(784438) poly(A) binding protein, cytoplasmic 1-like 2A
cow(521086) poly(A) binding protein, cytoplasmic 1-like 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012977 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012977 Rosetta Predictions human pricing
XM_001054954 Rosetta Predictions rat pricing
XM_228576 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220267 predicted 549
2 SASI_Hs01_00220268 predicted 554
3 SASI_Hs01_00220269 predicted 553
4 SASI_Hs01_00220270 predicted 300
5 SASI_Hs01_00220271 predicted 362
6 SASI_Hs01_00220272 predicted 293
7 SASI_Hs01_00220273 predicted 551
8 SASI_Hs01_00220274 predicted 289
9 SASI_Hs01_00220275 predicted 505
10 SASI_Hs01_00220266 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277802 predicted 1007
2 SASI_Rn02_00277803 predicted 1225
3 SASI_Rn02_00277804 predicted 966
4 SASI_Rn02_00277805 predicted 979
5 SASI_Rn02_00277806 predicted 1087
6 SASI_Rn02_00277807 predicted 962
7 SASI_Rn02_00277808 predicted 964
8 SASI_Rn02_00277809 predicted 1083
9 SASI_Rn02_00277810 predicted 914
10 SASI_Rn02_00277811 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385240 predicted 1362
2 SASI_Rn02_00385241 predicted 1347
3 SASI_Rn02_00385242 predicted 1352
4 SASI_Rn02_00385243 predicted 1334
5 SASI_Rn02_00385244 predicted 1345
6 SASI_Rn02_00385245 predicted 1333
7 SASI_Rn02_00385246 predicted 1336
8 SASI_Rn02_00385247 predicted 1338
9 SASI_Rn02_00385248 predicted 1351
10 SASI_Rn02_00385249 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012977
PABPC1L2A MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 1-like 2A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1469s1c1
Sequence:CCGGGCCTAGTTCTTTCCCTGTGTTCTCGAGAACACAGGGAAAGAACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1843s1c1
Sequence:CCGGGCTGGAAACAAACACTGCTTACTCGAGTAAGCAGTGTTTGTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-573s1c1
Sequence:CCGGGAATGGCATGTTCCTGAACTACTCGAGTAGTTCAGGAACATGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-618s1c1
Sequence:CCGGCAAGTCGCATAAAGAACGAGACTCGAGTCTCGTTCTTTATGCGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1353s1c1
Sequence:CCGGCCATGTTATCAACAGGCTTATCTCGAGATAAGCCTGTTGATAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1482s1c1
Sequence:CCGGCCTGTGTTTAAGACCAACATTCTCGAGAATGTTGGTCTTAAACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012977
PABPC1L2A MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 1-like 2A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1469s1c1
Sequence:CCGGGCCTAGTTCTTTCCCTGTGTTCTCGAGAACACAGGGAAAGAACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1843s1c1
Sequence:CCGGGCTGGAAACAAACACTGCTTACTCGAGTAAGCAGTGTTTGTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-573s1c1
Sequence:CCGGGAATGGCATGTTCCTGAACTACTCGAGTAGTTCAGGAACATGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-618s1c1
Sequence:CCGGCAAGTCGCATAAAGAACGAGACTCGAGTCTCGTTCTTTATGCGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1353s1c1
Sequence:CCGGCCATGTTATCAACAGGCTTATCTCGAGATAAGCCTGTTGATAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1482s1c1
Sequence:CCGGCCTGTGTTTAAGACCAACATTCTCGAGAATGTTGGTCTTAAACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012977
PABPC1L2A MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 1-like 2A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1469s1c1
Sequence:CCGGGCCTAGTTCTTTCCCTGTGTTCTCGAGAACACAGGGAAAGAACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1843s1c1
Sequence:CCGGGCTGGAAACAAACACTGCTTACTCGAGTAAGCAGTGTTTGTTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-573s1c1
Sequence:CCGGGAATGGCATGTTCCTGAACTACTCGAGTAGTTCAGGAACATGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012977.1-618s1c1
Sequence:CCGGCAAGTCGCATAAAGAACGAGACTCGAGTCTCGTTCTTTATGCGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1353s1c1
Sequence:CCGGCCATGTTATCAACAGGCTTATCTCGAGATAAGCCTGTTGATAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012977.1-1482s1c1
Sequence:CCGGCCTGTGTTTAAGACCAACATTCTCGAGAATGTTGGTCTTAAACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)