EMAIL THIS PAGE TO A FRIEND

PABPC1L2B

poly(A) binding protein, cytoplasmic 1-like 2B

24 Gene Product Result for
Synonyms: RBM32B
Gene ID:
dog(491958) poly(A) binding protein, cytoplasmic 1-like 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305856 ANTI-PABPC1L2B(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042506 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230641 MISSION® esiRNA esiRNA targeting human PABPC1L2B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042506 Rosetta Predictions human pricing
XM_928939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310208 predicted 553
2 SASI_Hs02_00310209 predicted 552
3 SASI_Hs02_00310210 predicted 559
4 SASI_Hs02_00310211 predicted 304
5 SASI_Hs02_00310212 predicted 362
6 SASI_Hs02_00310213 predicted 300
7 SASI_Hs02_00310214 predicted 556
8 SASI_Hs02_00310215 predicted 294
9 SASI_Hs02_00310216 predicted 511
10 SASI_Hs02_00310217 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250388 predicted 1443
2 SASI_Hs01_00250389 predicted 962
3 SASI_Hs01_00250390 predicted 208
4 SASI_Hs01_00250391 predicted 1047
5 SASI_Hs01_00250392 predicted 180
6 SASI_Hs01_00250393 predicted 125
7 SASI_Hs01_00250394 predicted 983
8 SASI_Hs01_00250395 predicted 993
9 SASI_Hs01_00250396 predicted 1359
10 SASI_Hs01_00250397 predicted 1447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042506
PABPC1L2B MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 1-like 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-561s21c1
Sequence:CCGGGGGCCATCGATGTGATGAATGCTCGAGCATTCATCACATCGATGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-432s21c1
Sequence:CCGGTCGACAACAAGGCGCTGTACACTCGAGTGTACAGCGCCTTGTTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-615s21c1
Sequence:CCGGGGAGATTCAAGTCGCATAAAGCTCGAGCTTTATGCGACTTGAATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042506.1-1961s21c1
Sequence:CCGGTCACGAAGCAGACAAGTTAACCTCGAGGTTAACTTGTCTGCTTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-315s21c1
Sequence:CCGGCCCTGAACTTTGATGTCATAACTCGAGTTATGACATCAAAGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042506
PABPC1L2B MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 1-like 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-561s21c1
Sequence:CCGGGGGCCATCGATGTGATGAATGCTCGAGCATTCATCACATCGATGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-432s21c1
Sequence:CCGGTCGACAACAAGGCGCTGTACACTCGAGTGTACAGCGCCTTGTTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-615s21c1
Sequence:CCGGGGAGATTCAAGTCGCATAAAGCTCGAGCTTTATGCGACTTGAATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042506.1-1961s21c1
Sequence:CCGGTCACGAAGCAGACAAGTTAACCTCGAGGTTAACTTGTCTGCTTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-315s21c1
Sequence:CCGGCCCTGAACTTTGATGTCATAACTCGAGTTATGACATCAAAGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042506
PABPC1L2B MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 1-like 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-561s21c1
Sequence:CCGGGGGCCATCGATGTGATGAATGCTCGAGCATTCATCACATCGATGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-432s21c1
Sequence:CCGGTCGACAACAAGGCGCTGTACACTCGAGTGTACAGCGCCTTGTTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-615s21c1
Sequence:CCGGGGAGATTCAAGTCGCATAAAGCTCGAGCTTTATGCGACTTGAATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042506.1-1961s21c1
Sequence:CCGGTCACGAAGCAGACAAGTTAACCTCGAGGTTAACTTGTCTGCTTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042506.1-315s21c1
Sequence:CCGGCCCTGAACTTTGATGTCATAACTCGAGTTATGACATCAAAGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)