EMAIL THIS PAGE TO A FRIEND

PABPC4

poly(A) binding protein, cytoplasmic 4 (inducible form)

33 Gene Product Result for
Synonyms: APP-1 APP1 PABP4 iPABP
UniProtKB ID: Q13310, B1ANQ8, Q4VC03, Q6P0N3
Gene ID:
Human(8761) Summary: Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(230721) poly(A) binding protein, cytoplasmic 4
Rat(298510) poly(A) binding protein, cytoplasmic 4
Zebrafish(321035) poly(A) binding protein, cytoplasmic 4 (inducible form)
dog(482464) poly(A) binding protein, cytoplasmic 4 (inducible form)
Horse(100054235) poly(A) binding protein, cytoplasmic 4 (inducible form)
cow(534576) poly(A) binding protein, cytoplasmic 4 (inducible form)
domestic cat(101095427) poly(A) binding protein, cytoplasmic 4 (inducible form)
chicken(419674) poly(A) binding protein, cytoplasmic 4 (inducible form)
domestic guinea pig(100717325) poly(A) binding protein, cytoplasmic 4 (inducible form)
naked mole-rat(101712162) poly(A) binding protein, cytoplasmic 4 (inducible form)
Domestic Rabbit(100340846) poly(A) binding protein, cytoplasmic 4 (inducible form)
sheep(101118742) poly(A) binding protein, cytoplasmic 4 (inducible form)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003819 Rosetta Predictions human pricing
NM_001100538 Rosetta Predictions rat pricing
NM_130881 Rosetta Predictions mouse pricing
NM_148917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165913 predicted 1288
2 SASI_Hs01_00165914 predicted 1668
3 SASI_Hs01_00165916 predicted 1012
4 SASI_Hs01_00165917 predicted 1757
5 SASI_Hs01_00165918 predicted 2011
6 SASI_Hs01_00165919 predicted 1617
7 SASI_Hs01_00165920 predicted 1276
8 SASI_Hs01_00165921 predicted 2567
9 SASI_Hs02_00336364 predicted 1744
10 SASI_Hs02_00336365 predicted 1274
11 SASI_Hs01_00165915 predicted 2640
12 SASI_Hs01_00165922 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209988 predicted 1623
2 SASI_Rn02_00209989 predicted 394
3 SASI_Rn02_00209990 predicted 1244
4 SASI_Rn02_00209991 predicted 575
5 SASI_Rn02_00209992 predicted 877
6 SASI_Rn02_00209993 predicted 1274
7 SASI_Rn02_00209994 predicted 1304
8 SASI_Rn02_00209995 predicted 1016
9 SASI_Rn02_00209996 predicted 990
10 SASI_Rn02_00209997 predicted 2096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153728 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089736 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003819
VALIDATED
PABPC4 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 4 (inducible form)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2147s21c1
Sequence:CCGGCAGGGAAGGCCTCCATATTATCTCGAGATAATATGGAGGCCTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1970s21c1
Sequence:CCGGGTGGGCTCCAAGCCACTATATCTCGAGATATAGTGGCTTGGAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1751s21c1
Sequence:CCGGCAGGAGAGAATTAGTCGATATCTCGAGATATCGACTAATTCTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2918s21c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1865s21c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1708s21c1
Sequence:CCGGAGAACGGCAGGCAGAGTTAAACTCGAGTTTAACTCTGCCTGCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1761s1c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003819.2-1292s1c1
Sequence:CCGGCAAAGTATTTGTGGGCAGATTCTCGAGAATCTGCCCACAAATACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1130s1c1
Sequence:CCGGCAAGGCACTTTATGATACTTTCTCGAGAAAGTATCATAAAGTGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2814s1c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2051s1c1
Sequence:CCGGGCCTCCATATTATACACCTAACTCGAGTTAGGTGTATAATATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003819
VALIDATED
PABPC4 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 4 (inducible form)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2147s21c1
Sequence:CCGGCAGGGAAGGCCTCCATATTATCTCGAGATAATATGGAGGCCTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1970s21c1
Sequence:CCGGGTGGGCTCCAAGCCACTATATCTCGAGATATAGTGGCTTGGAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1751s21c1
Sequence:CCGGCAGGAGAGAATTAGTCGATATCTCGAGATATCGACTAATTCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2918s21c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1865s21c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1708s21c1
Sequence:CCGGAGAACGGCAGGCAGAGTTAAACTCGAGTTTAACTCTGCCTGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1761s1c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003819.2-1292s1c1
Sequence:CCGGCAAAGTATTTGTGGGCAGATTCTCGAGAATCTGCCCACAAATACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1130s1c1
Sequence:CCGGCAAGGCACTTTATGATACTTTCTCGAGAAAGTATCATAAAGTGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2814s1c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2051s1c1
Sequence:CCGGGCCTCCATATTATACACCTAACTCGAGTTAGGTGTATAATATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003819
VALIDATED
PABPC4 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 4 (inducible form)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2147s21c1
Sequence:CCGGCAGGGAAGGCCTCCATATTATCTCGAGATAATATGGAGGCCTTCCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1970s21c1
Sequence:CCGGGTGGGCTCCAAGCCACTATATCTCGAGATATAGTGGCTTGGAGCCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1751s21c1
Sequence:CCGGCAGGAGAGAATTAGTCGATATCTCGAGATATCGACTAATTCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-2918s21c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003819.3-1865s21c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003819.3-1708s21c1
Sequence:CCGGAGAACGGCAGGCAGAGTTAAACTCGAGTTTAACTCTGCCTGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1761s1c1
Sequence:CCGGGCTAAGGTAATGCTGGAGGATCTCGAGATCCTCCAGCATTACCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003819.2-1292s1c1
Sequence:CCGGCAAAGTATTTGTGGGCAGATTCTCGAGAATCTGCCCACAAATACTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-1130s1c1
Sequence:CCGGCAAGGCACTTTATGATACTTTCTCGAGAAAGTATCATAAAGTGCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2814s1c1
Sequence:CCGGCCTCAACACCAAGGATTACAACTCGAGTTGTAATCCTTGGTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003819.2-2051s1c1
Sequence:CCGGGCCTCCATATTATACACCTAACTCGAGTTAGGTGTATAATATGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130881
VALIDATED
PABPC4 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 4 (inducible form)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1019s1c1
Sequence:CCGGCCTGGACAAATCCATAGACAACTCGAGTTGTCTATGGATTTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-2731s1c1
Sequence:CCGGCCAGCTAAGGTCTGAAGACATCTCGAGATGTCTTCAGACCTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1671s1c1
Sequence:CCGGGCGAAGGTGATGCTAGAAGATCTCGAGATCTTCTAGCATCACCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1339s1c1
Sequence:CCGGGCCAGTTTGGTAAGACCCTAACTCGAGTTAGGGTCTTACCAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1264s1c1
Sequence:CCGGCCAAGGAATTCACCAATGTTTCTCGAGAAACATTGGTGAATTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130881
VALIDATED
PABPC4 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 4 (inducible form)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1019s1c1
Sequence:CCGGCCTGGACAAATCCATAGACAACTCGAGTTGTCTATGGATTTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-2731s1c1
Sequence:CCGGCCAGCTAAGGTCTGAAGACATCTCGAGATGTCTTCAGACCTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1671s1c1
Sequence:CCGGGCGAAGGTGATGCTAGAAGATCTCGAGATCTTCTAGCATCACCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1339s1c1
Sequence:CCGGGCCAGTTTGGTAAGACCCTAACTCGAGTTAGGGTCTTACCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1264s1c1
Sequence:CCGGCCAAGGAATTCACCAATGTTTCTCGAGAAACATTGGTGAATTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130881
VALIDATED
PABPC4 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 4 (inducible form)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1019s1c1
Sequence:CCGGCCTGGACAAATCCATAGACAACTCGAGTTGTCTATGGATTTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-2731s1c1
Sequence:CCGGCCAGCTAAGGTCTGAAGACATCTCGAGATGTCTTCAGACCTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1671s1c1
Sequence:CCGGGCGAAGGTGATGCTAGAAGATCTCGAGATCTTCTAGCATCACCTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1339s1c1
Sequence:CCGGGCCAGTTTGGTAAGACCCTAACTCGAGTTAGGGTCTTACCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_130881.2-1264s1c1
Sequence:CCGGCCAAGGAATTCACCAATGTTTCTCGAGAAACATTGGTGAATTCCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)