EMAIL THIS PAGE TO A FRIEND

PABPC5

poly(A) binding protein, cytoplasmic 5

132 Gene Product Result for
Synonyms: PABP5
UniProtKB ID: Q96DU9, A8K240, Q5JQF4, Q6P529, Q9UFE5
Gene ID:
Human(140886) Summary: This gene encodes a protein that binds to the polyA tail found at the 3' end of most eukaryotic mRNAs. It is thought to play a role in the regulation of mRNA metabolic processes in the cytoplasm. This gene is located in a gene-poor region within the X-specific 13d-sY43 subinterval of the chromosome Xq21.3/Yp11.2 homology block. It is located close to translocation breakpoints associated with premature ovarian failure, and is therefore a potential candidate gene for this disorder. [provided by RefSeq, May 2010]
Mouse(93728) poly(A) binding protein, cytoplasmic 5
Rat(688518) poly A binding protein, cytoplasmic 5
Horse(100071995) poly(A) binding protein, cytoplasmic 5
domestic cat(101099028) poly(A) binding protein, cytoplasmic 5
dog(492002) poly(A) binding protein, cytoplasmic 5
Domestic Rabbit(100350595) poly(A) binding protein, cytoplasmic 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080832 Rosetta Predictions human pricing
NM_001110366 Rosetta Predictions rat pricing
NM_053114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233541 predicted 1011
2 SASI_Hs02_00362621 predicted 819
3 SASI_Hs01_00233542 predicted 453
4 SASI_Hs01_00233543 predicted 1018
5 SASI_Hs01_00233544 predicted 494
6 SASI_Hs01_00233547 predicted 1117
7 SASI_Hs01_00233548 predicted 911
8 SASI_Hs02_00362622 predicted 834
9 SASI_Hs01_00233549 predicted 777
10 SASI_Hs01_00233550 predicted 867
11 SASI_Hs01_00233545 predicted 705
12 SASI_Hs01_00233546 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251202 predicted 819
2 SASI_Rn02_00251203 predicted 216
3 SASI_Rn02_00251204 predicted 805
4 SASI_Rn02_00251205 predicted 657
5 SASI_Rn02_00251206 predicted 664
6 SASI_Rn02_00251207 predicted 824
7 SASI_Rn02_00251208 predicted 1141
8 SASI_Rn02_00251209 predicted 1097
9 SASI_Rn02_00251210 predicted 1067
10 SASI_Rn02_00251211 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121431 predicted 648
2 SASI_Mm01_00121433 predicted 268
3 SASI_Mm01_00121434 predicted 921
4 SASI_Mm02_00337622 predicted 824
5 SASI_Mm01_00121435 predicted 913
6 SASI_Mm01_00121436 predicted 602
7 SASI_Mm01_00121437 predicted 776
8 SASI_Mm01_00121438 predicted 690
9 SASI_Mm01_00121439 predicted 923
10 SASI_Mm01_00121440 predicted 840
11 SASI_Mm01_00121432 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080832
PABPC5 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080832.2-1864s21c1
Sequence:CCGGTGAGGCAATTGATTGAGTATACTCGAGTATACTCAATCAATTGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-1600s1c1
Sequence:CCGGGCTCAGTTTGTTTCAGCCTTACTCGAGTAAGGCTGAAACAAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2187s1c1
Sequence:CCGGCGTATTAACTTCTTGCCCAAACTCGAGTTTGGGCAAGAAGTTAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-530s1c1
Sequence:CCGGCGAGGACATGCTCTATAAGAACTCGAGTTCTTATAGAGCATGTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080832.2-745s21c1
Sequence:CCGGAGTCTGGAGTGGGAAATATATCTCGAGATATATTTCCCACTCCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-1024s1c1
Sequence:CCGGGAGCAACTTTCACCAATGTTTCTCGAGAAACATTGGTGAAAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-845s1c1
Sequence:CCGGCAAAGTCGTATGCGATGACAACTCGAGTTGTCATCGCATACGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2201s1c1
Sequence:CCGGGCCCAAAGAAGTAAGCATATTCTCGAGAATATGCTTACTTCTTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080832
PABPC5 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080832.2-1864s21c1
Sequence:CCGGTGAGGCAATTGATTGAGTATACTCGAGTATACTCAATCAATTGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-1600s1c1
Sequence:CCGGGCTCAGTTTGTTTCAGCCTTACTCGAGTAAGGCTGAAACAAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2187s1c1
Sequence:CCGGCGTATTAACTTCTTGCCCAAACTCGAGTTTGGGCAAGAAGTTAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-530s1c1
Sequence:CCGGCGAGGACATGCTCTATAAGAACTCGAGTTCTTATAGAGCATGTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080832.2-745s21c1
Sequence:CCGGAGTCTGGAGTGGGAAATATATCTCGAGATATATTTCCCACTCCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-1024s1c1
Sequence:CCGGGAGCAACTTTCACCAATGTTTCTCGAGAAACATTGGTGAAAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-845s1c1
Sequence:CCGGCAAAGTCGTATGCGATGACAACTCGAGTTGTCATCGCATACGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2201s1c1
Sequence:CCGGGCCCAAAGAAGTAAGCATATTCTCGAGAATATGCTTACTTCTTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080832
PABPC5 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080832.2-1864s21c1
Sequence:CCGGTGAGGCAATTGATTGAGTATACTCGAGTATACTCAATCAATTGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-1600s1c1
Sequence:CCGGGCTCAGTTTGTTTCAGCCTTACTCGAGTAAGGCTGAAACAAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2187s1c1
Sequence:CCGGCGTATTAACTTCTTGCCCAAACTCGAGTTTGGGCAAGAAGTTAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-530s1c1
Sequence:CCGGCGAGGACATGCTCTATAAGAACTCGAGTTCTTATAGAGCATGTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080832.2-745s21c1
Sequence:CCGGAGTCTGGAGTGGGAAATATATCTCGAGATATATTTCCCACTCCAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-1024s1c1
Sequence:CCGGGAGCAACTTTCACCAATGTTTCTCGAGAAACATTGGTGAAAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080832.1-845s1c1
Sequence:CCGGCAAAGTCGTATGCGATGACAACTCGAGTTGTCATCGCATACGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080832.1-2201s1c1
Sequence:CCGGGCCCAAAGAAGTAAGCATATTCTCGAGAATATGCTTACTTCTTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053114
PABPC5 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-552s1c1
Sequence:CCGGCGTTTAAGAAAGTCTGGAGTTCTCGAGAACTCCAGACTTTCTTAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053114.1-1461s1c1
Sequence:CCGGCCTTTGTGACAGAGGTTATTTCTCGAGAAATAACCTCTGTCACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1101s1c1
Sequence:CCGGGCTGAATTAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1245s1c1
Sequence:CCGGCGAGCCAAAGTGATGATGGAACTCGAGTTCCATCATCACTTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-775s1c1
Sequence:CCGGGCCAGGTATATGTTGGTCGATCTCGAGATCGACCAACATATACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053114
PABPC5 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-552s1c1
Sequence:CCGGCGTTTAAGAAAGTCTGGAGTTCTCGAGAACTCCAGACTTTCTTAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053114.1-1461s1c1
Sequence:CCGGCCTTTGTGACAGAGGTTATTTCTCGAGAAATAACCTCTGTCACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1101s1c1
Sequence:CCGGGCTGAATTAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1245s1c1
Sequence:CCGGCGAGCCAAAGTGATGATGGAACTCGAGTTCCATCATCACTTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-775s1c1
Sequence:CCGGGCCAGGTATATGTTGGTCGATCTCGAGATCGACCAACATATACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053114
PABPC5 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-552s1c1
Sequence:CCGGCGTTTAAGAAAGTCTGGAGTTCTCGAGAACTCCAGACTTTCTTAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053114.1-1461s1c1
Sequence:CCGGCCTTTGTGACAGAGGTTATTTCTCGAGAAATAACCTCTGTCACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1101s1c1
Sequence:CCGGGCTGAATTAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-1245s1c1
Sequence:CCGGCGAGCCAAAGTGATGATGGAACTCGAGTTCCATCATCACTTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053114.1-775s1c1
Sequence:CCGGGCCAGGTATATGTTGGTCGATCTCGAGATCGACCAACATATACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)