EMAIL THIS PAGE TO A FRIEND

PABPN1

poly(A) binding protein, nuclear 1

116 Gene Product Result for
Synonyms: OPMD PAB2 PABII PABP-2 PABP2
UniProtKB ID: Q86U42, D3DS49, O43484
Gene ID:
Human(8106) Summary: This gene encodes an abundant nuclear protein that binds with high affinity to nascent poly(A) tails. The protein is required for progressive and efficient polymerization of poly(A) tails at the 3' ends of eukaryotic transcripts and controls the size of the poly(A) tail to about 250 nt. At steady-state, this protein is localized in the nucleus whereas a different poly(A) binding protein is localized in the cytoplasm. This gene contains a GCG trinucleotide repeat at the 5' end of the coding region, and expansion of this repeat from the normal 6 copies to 8-13 copies leads to autosomal dominant oculopharyngeal muscular dystrophy (OPMD) disease. Related pseudogenes have been identified on chromosomes 19 and X. Read-through transcription also exists between this gene and the neighboring upstream BCL2-like 2 (BCL2L2) gene. [provided by RefSeq, Dec 2010]
Mouse(54196) poly(A) binding protein, nuclear 1
Rat(116697) poly(A) binding protein, nuclear 1
domestic guinea pig(100728725) poly(A) binding protein, nuclear 1
naked mole-rat(101714601) poly(A) binding protein, nuclear 1
Zebrafish(406543) poly(A) binding protein, nuclear 1
dog(100170671) poly(A) binding protein, nuclear 1
chicken(769028) poly(A) binding protein, nuclear 1
cow(282298) poly(A) binding protein, nuclear 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004643 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027651 MISSION® esiRNA esiRNA targeting mouse Pabpn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004643 Rosetta Predictions human pricing
NM_001135008 Rosetta Predictions rat pricing
XM_001055786 Rosetta Predictions rat pricing
NM_019402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239512 predicted 1739
2 SASI_Hs01_00239513 predicted 1936
3 SASI_Hs01_00239514 predicted 1861
4 SASI_Hs01_00239516 predicted 1909
5 SASI_Hs01_00239517 predicted 1719
6 SASI_Hs01_00239518 predicted 1813
7 SASI_Hs01_00239519 predicted 1925
8 SASI_Hs01_00239520 predicted 1971
9 SASI_Hs01_00239521 predicted 1780
10 SASI_Hs02_00338052 predicted 1968
11 SASI_Hs01_00239515 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259407 predicted 632
2 SASI_Rn02_00259408 predicted 421
3 SASI_Rn02_00259409 predicted 640
4 SASI_Rn02_00259410 predicted 585
5 SASI_Rn02_00259411 predicted 509
6 SASI_Rn02_00259412 predicted 711
7 SASI_Rn02_00259413 predicted 419
8 SASI_Rn02_00259414 predicted 424
9 SASI_Rn02_00259415 predicted 657
10 SASI_Rn02_00259416 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281005 predicted 630
2 SASI_Rn02_00281006 predicted 417
3 SASI_Rn02_00281007 predicted 639
4 SASI_Rn02_00281008 predicted 586
5 SASI_Rn02_00281009 predicted 512
6 SASI_Rn02_00281010 predicted 707
7 SASI_Rn02_00281011 predicted 427
8 SASI_Rn02_00281012 predicted 422
9 SASI_Rn02_00281013 predicted 663
10 SASI_Rn02_00281014 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071323 predicted 501
2 SASI_Mm01_00071324 predicted 613
3 SASI_Mm01_00071325 predicted 564
4 SASI_Mm01_00071326 predicted 446
5 SASI_Mm01_00071327 predicted 489
6 SASI_Mm01_00071328 predicted 516
7 SASI_Mm01_00071329 predicted 621
8 SASI_Mm01_00071332 predicted 460
9 SASI_Mm02_00324322 predicted 380
10 SASI_Mm02_00324323 predicted 636
11 SASI_Mm01_00071330 predicted 583
12 SASI_Mm01_00071331 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019402
VALIDATED
PABPN1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, nuclear 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-572s1c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-502s1c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-692s1c1
Sequence:CCGGCCCTGTTCAGAGGAAGACAAACTCGAGTTTGTCTTCCTCTGAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-622s1c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-501s1c1
Sequence:CCGGCCGCTCTATCTACGTTGGCAACTCGAGTTGCCAACGTAGATAGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-572s21c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019402.1-414s21c1
Sequence:CCGGGGTAGAGAAGCAGATGAATATCTCGAGATATTCATCTGCTTCTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-502s21c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-622s21c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-879s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019402
VALIDATED
PABPN1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, nuclear 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-572s1c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-502s1c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-692s1c1
Sequence:CCGGCCCTGTTCAGAGGAAGACAAACTCGAGTTTGTCTTCCTCTGAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-622s1c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-501s1c1
Sequence:CCGGCCGCTCTATCTACGTTGGCAACTCGAGTTGCCAACGTAGATAGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-572s21c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019402.1-414s21c1
Sequence:CCGGGGTAGAGAAGCAGATGAATATCTCGAGATATTCATCTGCTTCTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-502s21c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-622s21c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-879s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019402
VALIDATED
PABPN1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, nuclear 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-572s1c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-502s1c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-692s1c1
Sequence:CCGGCCCTGTTCAGAGGAAGACAAACTCGAGTTTGTCTTCCTCTGAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-622s1c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019402.1-501s1c1
Sequence:CCGGCCGCTCTATCTACGTTGGCAACTCGAGTTGCCAACGTAGATAGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-572s21c1
Sequence:CCGGGTGGTTCAGTCAACCGTGTTACTCGAGTAACACGGTTGACTGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019402.1-414s21c1
Sequence:CCGGGGTAGAGAAGCAGATGAATATCTCGAGATATTCATCTGCTTCTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-502s21c1
Sequence:CCGGCGCTCTATCTACGTTGGCAATCTCGAGATTGCCAACGTAGATAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-622s21c1
Sequence:CCGGCCCAAAGGGTTTGCATATATACTCGAGTATATATGCAAACCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019402.1-879s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004643
VALIDATED
PABPN1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, nuclear 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2355s1c1
Sequence:CCGGCCCATAACTAACTGCTGAGGACTCGAGTCCTCAGCAGTTAGTTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1706s1c1
Sequence:CCGGGAGGTAGAGAAGCAGATGAATCTCGAGATTCATCTGCTTCTCTACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2113s1c1
Sequence:CCGGCTCTCGATTCTACAGTGGTTTCTCGAGAAACCACTGTAGAATCGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004643.x-1718s1c1
Sequence:CCGGCAGATGAATATGAGTCCACCTCTCGAGAGGTGGACTCATATTCATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1707s1c1
Sequence:CCGGAGGTAGAGAAGCAGATGAATACTCGAGTATTCATCTGCTTCTCTACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1974s21c1
Sequence:CCGGCCTTAGATGAGTCCCTATTTACTCGAGTAAATAGGGACTCATCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-2173s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004643.2-2584s21c1
Sequence:CCGGCCAAACTGTTCTGCTTGTTACCTCGAGGTAACAAGCAGAACAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1916s21c1
Sequence:CCGGCCCAAAGGGTTTGCGTATATACTCGAGTATATACGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1886s21c1
Sequence:CCGGACCATACTGTGTGACAAATTTCTCGAGAAATTTGTCACACAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004643
VALIDATED
PABPN1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, nuclear 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2355s1c1
Sequence:CCGGCCCATAACTAACTGCTGAGGACTCGAGTCCTCAGCAGTTAGTTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1706s1c1
Sequence:CCGGGAGGTAGAGAAGCAGATGAATCTCGAGATTCATCTGCTTCTCTACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2113s1c1
Sequence:CCGGCTCTCGATTCTACAGTGGTTTCTCGAGAAACCACTGTAGAATCGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004643.x-1718s1c1
Sequence:CCGGCAGATGAATATGAGTCCACCTCTCGAGAGGTGGACTCATATTCATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1707s1c1
Sequence:CCGGAGGTAGAGAAGCAGATGAATACTCGAGTATTCATCTGCTTCTCTACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1974s21c1
Sequence:CCGGCCTTAGATGAGTCCCTATTTACTCGAGTAAATAGGGACTCATCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-2173s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004643.2-2584s21c1
Sequence:CCGGCCAAACTGTTCTGCTTGTTACCTCGAGGTAACAAGCAGAACAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1916s21c1
Sequence:CCGGCCCAAAGGGTTTGCGTATATACTCGAGTATATACGCAAACCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1886s21c1
Sequence:CCGGACCATACTGTGTGACAAATTTCTCGAGAAATTTGTCACACAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004643
VALIDATED
PABPN1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, nuclear 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2355s1c1
Sequence:CCGGCCCATAACTAACTGCTGAGGACTCGAGTCCTCAGCAGTTAGTTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1706s1c1
Sequence:CCGGGAGGTAGAGAAGCAGATGAATCTCGAGATTCATCTGCTTCTCTACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-2113s1c1
Sequence:CCGGCTCTCGATTCTACAGTGGTTTCTCGAGAAACCACTGTAGAATCGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004643.x-1718s1c1
Sequence:CCGGCAGATGAATATGAGTCCACCTCTCGAGAGGTGGACTCATATTCATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004643.x-1707s1c1
Sequence:CCGGAGGTAGAGAAGCAGATGAATACTCGAGTATTCATCTGCTTCTCTACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1974s21c1
Sequence:CCGGCCTTAGATGAGTCCCTATTTACTCGAGTAAATAGGGACTCATCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-2173s21c1
Sequence:CCGGTAGAGCGACATCATGGTATTCCTCGAGGAATACCATGATGTCGCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004643.2-2584s21c1
Sequence:CCGGCCAAACTGTTCTGCTTGTTACCTCGAGGTAACAAGCAGAACAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1916s21c1
Sequence:CCGGCCCAAAGGGTTTGCGTATATACTCGAGTATATACGCAAACCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004643.2-1886s21c1
Sequence:CCGGACCATACTGTGTGACAAATTTCTCGAGAAATTTGTCACACAGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)