EMAIL THIS PAGE TO A FRIEND

PABPN1L

poly(A) binding protein, nuclear 1-like (cytoplasmic)

52 Gene Product Result for
Synonyms: PABPNL1 ePABP2
UniProtKB ID: A6NDY0, A1L3B3, A2VDI2
Gene ID:
Mouse(382035) poly(A)binding protein nuclear 1-like
Rat(307920) poly(A)binding protein nuclear 1-like
Zebrafish(100170402) poly(A) binding protein, nuclear 1, like
cow(617429) poly(A) binding protein, nuclear 1-like (cytoplasmic)
domestic cat(101092223) poly(A) binding protein, nuclear 1-like (cytoplasmic)
dog(608851) poly(A) binding protein, nuclear 1-like (cytoplasmic)
sheep(101108854) poly(A) binding protein, nuclear 1-like (cytoplasmic)
naked mole-rat(101710651) poly(A) binding protein, nuclear 1-like (cytoplasmic)
domestic guinea pig(100731230) poly(A) binding protein, nuclear 1-like (cytoplasmic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080487 Rosetta Predictions human pricing
XM_372648 Rosetta Predictions human pricing
NM_001113779 Rosetta Predictions rat pricing
NM_001007462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315316 predicted 524
2 SASI_Hs02_00315317 predicted 554
3 SASI_Hs02_00315318 predicted 519
4 SASI_Hs02_00315319 predicted 529
5 SASI_Hs02_00315320 predicted 518
6 SASI_Hs02_00315321 predicted 486
7 SASI_Hs02_00315322 predicted 562
8 SASI_Hs02_00315323 predicted 516
9 SASI_Hs02_00315324 predicted 437
10 SASI_Hs02_00315325 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274807 predicted 534
2 SASI_Hs01_00274808 predicted 563
3 SASI_Hs01_00274809 predicted 530
4 SASI_Hs01_00274810 predicted 532
5 SASI_Hs01_00274811 predicted 522
6 SASI_Hs01_00274812 predicted 489
7 SASI_Hs01_00274813 predicted 567
8 SASI_Hs01_00274814 predicted 532
9 SASI_Hs01_00274815 predicted 518
10 SASI_Hs01_00274816 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252053 predicted 483
2 SASI_Rn02_00252054 predicted 763
3 SASI_Rn02_00252055 predicted 662
4 SASI_Rn02_00252056 predicted 685
5 SASI_Rn02_00252057 predicted 293
6 SASI_Rn02_00252058 predicted 395
7 SASI_Rn02_00252059 predicted 886
8 SASI_Rn02_00252060 predicted 451
9 SASI_Rn02_00252061 predicted 583
10 SASI_Rn02_00252062 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180748 predicted 571
2 SASI_Mm01_00180750 predicted 619
3 SASI_Mm01_00180751 predicted 606
4 SASI_Mm01_00180752 predicted 786
5 SASI_Mm01_00180753 predicted 858
6 SASI_Mm01_00180754 predicted 560
7 SASI_Mm01_00180755 predicted 690
8 SASI_Mm01_00180756 predicted 483
9 SASI_Mm01_00180757 predicted 708
10 SASI_Mm02_00286730 predicted 578
11 SASI_Mm01_00180749 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080487
PABPN1L MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-101s21c1
Sequence:CCGGACGAGACCAAGGAGATTCTGGCTCGAGCCAGAATCTCCTTGGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-646s21c1
Sequence:CCGGGTCATCAAGGTGCTGCCGAAACTCGAGTTTCGGCAGCACCTTGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-566s21c1
Sequence:GTACCGGGTTATGCCTACATAGAGTTTGCTCGAGCAAACTCTATGTAGGCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-529s21c1
Sequence:CCGGACGATCCTGTGTGACAAGTTCCTCGAGGAACTTGTCACACAGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-432s21c1
Sequence:CCGGTGACCACAGATCCGTCTACGTCTCGAGACGTAGACGGATCTGTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080487
PABPN1L MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-101s21c1
Sequence:CCGGACGAGACCAAGGAGATTCTGGCTCGAGCCAGAATCTCCTTGGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-646s21c1
Sequence:CCGGGTCATCAAGGTGCTGCCGAAACTCGAGTTTCGGCAGCACCTTGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-566s21c1
Sequence:GTACCGGGTTATGCCTACATAGAGTTTGCTCGAGCAAACTCTATGTAGGCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-529s21c1
Sequence:CCGGACGATCCTGTGTGACAAGTTCCTCGAGGAACTTGTCACACAGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-432s21c1
Sequence:CCGGTGACCACAGATCCGTCTACGTCTCGAGACGTAGACGGATCTGTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080487
PABPN1L MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-101s21c1
Sequence:CCGGACGAGACCAAGGAGATTCTGGCTCGAGCCAGAATCTCCTTGGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-646s21c1
Sequence:CCGGGTCATCAAGGTGCTGCCGAAACTCGAGTTTCGGCAGCACCTTGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-566s21c1
Sequence:GTACCGGGTTATGCCTACATAGAGTTTGCTCGAGCAAACTCTATGTAGGCATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-529s21c1
Sequence:CCGGACGATCCTGTGTGACAAGTTCCTCGAGGAACTTGTCACACAGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080487.1-432s21c1
Sequence:CCGGTGACCACAGATCCGTCTACGTCTCGAGACGTAGACGGATCTGTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007462
PABPN1L MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000102556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-606s1c1
Sequence:CCGGCCCAAGGGCTATGCATATATACTCGAGTATATATGCATAGCCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-287s1c1
Sequence:CCGGCCCAGTATTCAACCAGGAGTTCTCGAGAACTCCTGGTTGAATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-502s1c1
Sequence:CCGGGCAATGTGGATTATGGTGGCTCTCGAGAGCCACCATAATCCACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007462.1-908s1c1
Sequence:CCGGACCAGGAGTAAACTGCTGTCTCTCGAGAGACAGCAGTTTACTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007462
PABPN1L MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000102556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-606s1c1
Sequence:CCGGCCCAAGGGCTATGCATATATACTCGAGTATATATGCATAGCCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-287s1c1
Sequence:CCGGCCCAGTATTCAACCAGGAGTTCTCGAGAACTCCTGGTTGAATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-502s1c1
Sequence:CCGGGCAATGTGGATTATGGTGGCTCTCGAGAGCCACCATAATCCACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007462.1-908s1c1
Sequence:CCGGACCAGGAGTAAACTGCTGTCTCTCGAGAGACAGCAGTTTACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007462
PABPN1L MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, nuclear 1-like (cytoplasmic)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000102556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-606s1c1
Sequence:CCGGCCCAAGGGCTATGCATATATACTCGAGTATATATGCATAGCCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-287s1c1
Sequence:CCGGCCCAGTATTCAACCAGGAGTTCTCGAGAACTCCTGGTTGAATACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007462.1-502s1c1
Sequence:CCGGGCAATGTGGATTATGGTGGCTCTCGAGAGCCACCATAATCCACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007462.1-908s1c1
Sequence:CCGGACCAGGAGTAAACTGCTGTCTCTCGAGAGACAGCAGTTTACTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)