EMAIL THIS PAGE TO A FRIEND

PACRG

PARK2 co-regulated

105 Gene Product Result for
Synonyms: GLUP HAK005771 PARK2CRG RP3-495O10.2
UniProtKB ID: Q96M98, E1P5B5, Q6IMB8, Q8IZM1, Q8NHP5, Q9H1V9
Gene ID:
Human(135138) Summary: This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinson's disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinson's disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(69310) PARK2 co-regulated
Rat(499021) Park2 co-regulated
naked mole-rat(101724544) PARK2 co-regulated
domestic guinea pig(100731819) PARK2 co-regulated
sheep(101113075) PARK2 co-regulated
Zebrafish(492757) PARK2 co-regulated
dog(484071) PARK2 co-regulated
domestic cat(101095982) PARK2 co-regulated
cow(767959) PARK2 co-regulated
cow(100336821) PARK2 co-regulated
chicken(421576) PARK2 co-regulated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080378 Rosetta Predictions human pricing
NM_001080379 Rosetta Predictions human pricing
NM_152410 Rosetta Predictions human pricing
NM_001077677 Rosetta Predictions rat pricing
NM_027032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314371 predicted 1248
2 SASI_Hs02_00314372 predicted 1149
3 SASI_Hs02_00314373 predicted 572
4 SASI_Hs02_00314374 predicted 415
5 SASI_Hs02_00314375 predicted 524
6 SASI_Hs02_00314376 predicted 1030
7 SASI_Hs02_00314377 predicted 1144
8 SASI_Hs02_00314378 predicted 1270
9 SASI_Hs02_00314379 predicted 467
10 SASI_Hs02_00314380 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314381 predicted 1293
2 SASI_Hs02_00314382 predicted 1188
3 SASI_Hs02_00314383 predicted 617
4 SASI_Hs02_00314384 predicted 459
5 SASI_Hs02_00314385 predicted 565
6 SASI_Hs02_00314386 predicted 1075
7 SASI_Hs02_00314387 predicted 1180
8 SASI_Hs02_00314388 predicted 1305
9 SASI_Hs02_00314389 predicted 506
10 SASI_Hs02_00314390 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366101 predicted 1390
2 SASI_Hs01_00085395 predicted 1363
3 SASI_Hs02_00366102 predicted 1260
4 SASI_Hs02_00366103 predicted 412
5 SASI_Hs02_00366104 predicted 523
6 SASI_Hs02_00366105 predicted 1151
7 SASI_Hs01_00085398 predicted 1255
8 SASI_Hs02_00366106 predicted 1385
9 SASI_Hs01_00085401 predicted 468
10 SASI_Hs02_00366107 predicted 468
11 SASI_Hs01_00085393 predicted 499
12 SASI_Hs01_00085394 predicted 1332
13 SASI_Hs01_00085396 predicted 578
14 SASI_Hs01_00085397 predicted 424
15 SASI_Hs01_00085399 predicted 1340
16 SASI_Hs01_00085400 predicted 1387
17 SASI_Hs01_00085402 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207892 predicted 917
2 SASI_Rn02_00207893 predicted 420
3 SASI_Rn02_00207894 predicted 464
4 SASI_Rn02_00207895 predicted 691
5 SASI_Rn02_00207896 predicted 853
6 SASI_Rn02_00207897 predicted 415
7 SASI_Rn02_00207898 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143524 predicted 710
2 SASI_Mm01_00143526 predicted 841
3 SASI_Mm01_00143527 predicted 511
4 SASI_Mm01_00143528 predicted 839
5 SASI_Mm01_00143529 predicted 790
6 SASI_Mm01_00143530 predicted 742
7 SASI_Mm02_00331429 predicted 1099
8 SASI_Mm01_00143532 predicted 769
9 SASI_Mm01_00143533 predicted 767
10 SASI_Mm02_00331430 predicted 1124
11 SASI_Mm01_00143525 predicted 551
12 SASI_Mm01_00143531 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027032
PACRG MISSION shRNA Bacterial Glycerol Stock
PARK2 co-regulated
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027032.1-529s1c1
Sequence:CCGGGCATGACTCGAAAGGAAACAACTCGAGTTGTTTCCTTTCGAGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-745s1c1
Sequence:CCGGCCTCCGAAACAGACAGATCATCTCGAGATGATCTGTCTGTTTCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-760s1c1
Sequence:CCGGGATCATCTGTGTGACGCTCAACTCGAGTTGAGCGTCACACAGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-859s1c1
Sequence:CCGGCCTGAACATCTTTAAGAACATCTCGAGATGTTCTTAAAGATGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-556s1c1
Sequence:CCGGCTGGAAGGTTGAGATTGAGAACTCGAGTTCTCAATCTCAACCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027032.2-1104s1c1
Sequence:CCGGGTCCTAGCATCTCATTACTTGCTCGAGCAAGTAATGAGATGCTAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027032
PACRG MISSION shRNA shRNA Plasmid DNA
PARK2 co-regulated
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027032.1-529s1c1
Sequence:CCGGGCATGACTCGAAAGGAAACAACTCGAGTTGTTTCCTTTCGAGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-745s1c1
Sequence:CCGGCCTCCGAAACAGACAGATCATCTCGAGATGATCTGTCTGTTTCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-760s1c1
Sequence:CCGGGATCATCTGTGTGACGCTCAACTCGAGTTGAGCGTCACACAGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-859s1c1
Sequence:CCGGCCTGAACATCTTTAAGAACATCTCGAGATGTTCTTAAAGATGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-556s1c1
Sequence:CCGGCTGGAAGGTTGAGATTGAGAACTCGAGTTCTCAATCTCAACCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027032.2-1104s1c1
Sequence:CCGGGTCCTAGCATCTCATTACTTGCTCGAGCAAGTAATGAGATGCTAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027032
PACRG MISSION shRNA Lentiviral Transduction Particles
PARK2 co-regulated
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027032.1-529s1c1
Sequence:CCGGGCATGACTCGAAAGGAAACAACTCGAGTTGTTTCCTTTCGAGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-745s1c1
Sequence:CCGGCCTCCGAAACAGACAGATCATCTCGAGATGATCTGTCTGTTTCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-760s1c1
Sequence:CCGGGATCATCTGTGTGACGCTCAACTCGAGTTGAGCGTCACACAGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-859s1c1
Sequence:CCGGCCTGAACATCTTTAAGAACATCTCGAGATGTTCTTAAAGATGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027032.1-556s1c1
Sequence:CCGGCTGGAAGGTTGAGATTGAGAACTCGAGTTCTCAATCTCAACCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027032.2-1104s1c1
Sequence:CCGGGTCCTAGCATCTCATTACTTGCTCGAGCAAGTAATGAGATGCTAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152410
PACRG MISSION shRNA Bacterial Glycerol Stock
PARK2 co-regulated
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1247s1c1
Sequence:CCGGCCATTGGACTGTTAGCCCTATCTCGAGATAGGGCTAACAGTCCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-527s1c1
Sequence:CCGGGAAGCTGGATTACCATCATTACTCGAGTAATGATGGTAATCCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-251s1c1
Sequence:CCGGCTTAAACAAATGCCCAGACAACTCGAGTTGTCTGGGCATTTGTTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-932s1c1
Sequence:CCGGCTCTCAAGTAGCTGAGATTATCTCGAGATAATCTCAGCTACTTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-971s1c1
Sequence:CCGGCATTGACTACAGCCAGCAGAACTCGAGTTCTGCTGGCTGTAGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1192s1c1
Sequence:CCGGCCTTGTGACTTCCACAGCTTTCTCGAGAAAGCTGTGGAAGTCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-1090s1c1
Sequence:CCGGCCTACGAGTCTTGCTTGCTAACTCGAGTTAGCAAGCAAGACTCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152410.1-1389s1c1
Sequence:CCGGCGAGTTAAACCTTCAGTTGTACTCGAGTACAACTGAAGGTTTAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-525s1c1
Sequence:CCGGGAGAAGCTGGATTACCATCATCTCGAGATGATGGTAATCCAGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152410
PACRG MISSION shRNA shRNA Plasmid DNA
PARK2 co-regulated
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1247s1c1
Sequence:CCGGCCATTGGACTGTTAGCCCTATCTCGAGATAGGGCTAACAGTCCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-527s1c1
Sequence:CCGGGAAGCTGGATTACCATCATTACTCGAGTAATGATGGTAATCCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-251s1c1
Sequence:CCGGCTTAAACAAATGCCCAGACAACTCGAGTTGTCTGGGCATTTGTTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-932s1c1
Sequence:CCGGCTCTCAAGTAGCTGAGATTATCTCGAGATAATCTCAGCTACTTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-971s1c1
Sequence:CCGGCATTGACTACAGCCAGCAGAACTCGAGTTCTGCTGGCTGTAGTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1192s1c1
Sequence:CCGGCCTTGTGACTTCCACAGCTTTCTCGAGAAAGCTGTGGAAGTCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-1090s1c1
Sequence:CCGGCCTACGAGTCTTGCTTGCTAACTCGAGTTAGCAAGCAAGACTCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152410.1-1389s1c1
Sequence:CCGGCGAGTTAAACCTTCAGTTGTACTCGAGTACAACTGAAGGTTTAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-525s1c1
Sequence:CCGGGAGAAGCTGGATTACCATCATCTCGAGATGATGGTAATCCAGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152410
PACRG MISSION shRNA Lentiviral Transduction Particles
PARK2 co-regulated
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1247s1c1
Sequence:CCGGCCATTGGACTGTTAGCCCTATCTCGAGATAGGGCTAACAGTCCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-527s1c1
Sequence:CCGGGAAGCTGGATTACCATCATTACTCGAGTAATGATGGTAATCCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-251s1c1
Sequence:CCGGCTTAAACAAATGCCCAGACAACTCGAGTTGTCTGGGCATTTGTTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-932s1c1
Sequence:CCGGCTCTCAAGTAGCTGAGATTATCTCGAGATAATCTCAGCTACTTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-971s1c1
Sequence:CCGGCATTGACTACAGCCAGCAGAACTCGAGTTCTGCTGGCTGTAGTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152410.1-1192s1c1
Sequence:CCGGCCTTGTGACTTCCACAGCTTTCTCGAGAAAGCTGTGGAAGTCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152410.1-1090s1c1
Sequence:CCGGCCTACGAGTCTTGCTTGCTAACTCGAGTTAGCAAGCAAGACTCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152410.1-1389s1c1
Sequence:CCGGCGAGTTAAACCTTCAGTTGTACTCGAGTACAACTGAAGGTTTAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152410.1-525s1c1
Sequence:CCGGGAGAAGCTGGATTACCATCATCTCGAGATGATGGTAATCCAGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)