EMAIL THIS PAGE TO A FRIEND

PACRGL

PARK2 co-regulated-like

69 Gene Product Result for
Synonyms: C4orf28
UniProtKB ID: Q8N7B6, B2RDB9, B4DFF8, B4DMN7, Q8TBA8
Gene ID:
Mouse(66768) PARK2 co-regulated-like
Rat(360947) PARK2 co-regulated-like
chicken(422818) chromosome 4 open reading frame 28
domestic cat(101083931) PARK2 co-regulated-like
cow(527318) PARK2 co-regulated-like
dog(479130) PARK2 co-regulated-like
sheep(101123211) PARK2 co-regulated-like
domestic guinea pig(100728498) PARK2 co-regulated-like
naked mole-rat(101705763) PARK2 co-regulated-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145048 Rosetta Predictions human pricing
XM_001057772 Rosetta Predictions rat pricing
XM_341225 Rosetta Predictions rat pricing
NM_025755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364929 predicted 568
2 SASI_Hs01_00208574 predicted 403
3 SASI_Hs01_00208575 predicted 692
4 SASI_Hs01_00208576 predicted 737
5 SASI_Hs01_00208577 predicted 668
6 SASI_Hs01_00208579 predicted 390
7 SASI_Hs01_00208580 predicted 508
8 SASI_Hs01_00208581 predicted 511
9 SASI_Hs01_00208582 predicted 366
10 SASI_Hs01_00208583 predicted 607
11 SASI_Hs01_00208578 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287526 predicted 595
2 SASI_Rn02_00287527 predicted 760
3 SASI_Rn02_00287528 predicted 455
4 SASI_Rn02_00287529 predicted 900
5 SASI_Rn02_00287530 predicted 359
6 SASI_Rn02_00287531 predicted 445
7 SASI_Rn02_00287532 predicted 512
8 SASI_Rn02_00287533 predicted 419
9 SASI_Rn02_00287534 predicted 305
10 SASI_Rn02_00287535 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392613 predicted 590
2 SASI_Rn02_00392614 predicted 757
3 SASI_Rn02_00392615 predicted 452
4 SASI_Rn02_00392616 predicted 903
5 SASI_Rn02_00392617 predicted 353
6 SASI_Rn02_00392618 predicted 446
7 SASI_Rn02_00392619 predicted 512
8 SASI_Rn02_00392620 predicted 417
9 SASI_Rn02_00392621 predicted 307
10 SASI_Rn02_00392622 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106767 predicted 1001
2 SASI_Mm02_00328956 predicted 686
3 SASI_Mm01_00106768 predicted 811
4 SASI_Mm01_00106769 predicted 391
5 SASI_Mm01_00106770 predicted 381
6 SASI_Mm01_00106771 predicted 451
7 SASI_Mm01_00106772 predicted 796
8 SASI_Mm01_00106773 predicted 1007
9 SASI_Mm01_00106774 predicted 230
10 SASI_Mm01_00106775 predicted 440
11 SASI_Mm01_00106776 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145048
VALIDATED
PACRGL MISSION shRNA Bacterial Glycerol Stock
PARK2 co-regulated-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-727s21c1
Sequence:CCGGATTTGATCCACTTCTTATTACCTCGAGGTAATAAGAAGTGGATCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-897s21c1
Sequence:CCGGATTCGGATGATGAAGTGTTTGCTCGAGCAAACACTTCATCATCCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1107s21c1
Sequence:CCGGACTAACTGTGGGTACTCATTTCTCGAGAAATGAGTACCCACAGTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1392s21c1
Sequence:CCGGTTTGTAGCTGTGCCCTTATTTCTCGAGAAATAAGGGCACAGCTACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-367s1c1
Sequence:CCGGCCTTCTGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-413s1c1
Sequence:CCGGGATTGGTACATGGTTCAGTAACTCGAGTTACTGAACCATGTACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-1500s1c1
Sequence:CCGGGACTTCCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-685s1c1
Sequence:CCGGGTTCAGCTAAGTGTCGTTGTTCTCGAGAACAACGACACTTAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-608s1c1
Sequence:CCGGCTAGACTGATTCCTGTGCTAACTCGAGTTAGCACAGGAATCAGTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-752s1c1
Sequence:CCGGGCCTTAGCATCATCAAATCTACTCGAGTAGATTTGATGATGCTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-184s1c1
Sequence:CCGGGCAACAGGTAACTATGATCAACTCGAGTTGATCATAGTTACCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145048.2-1050s1c1
Sequence:CCGGGCGAAGAACCATTATTGAGTTCTCGAGAACTCAATAATGGTTCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-237s1c1
Sequence:CCGGGAATGCAGTTCAGGGAAGCAACTCGAGTTGCTTCCCTGAACTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145048
VALIDATED
PACRGL MISSION shRNA shRNA Plasmid DNA
PARK2 co-regulated-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-727s21c1
Sequence:CCGGATTTGATCCACTTCTTATTACCTCGAGGTAATAAGAAGTGGATCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-897s21c1
Sequence:CCGGATTCGGATGATGAAGTGTTTGCTCGAGCAAACACTTCATCATCCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1107s21c1
Sequence:CCGGACTAACTGTGGGTACTCATTTCTCGAGAAATGAGTACCCACAGTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1392s21c1
Sequence:CCGGTTTGTAGCTGTGCCCTTATTTCTCGAGAAATAAGGGCACAGCTACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-367s1c1
Sequence:CCGGCCTTCTGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-413s1c1
Sequence:CCGGGATTGGTACATGGTTCAGTAACTCGAGTTACTGAACCATGTACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-1500s1c1
Sequence:CCGGGACTTCCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-685s1c1
Sequence:CCGGGTTCAGCTAAGTGTCGTTGTTCTCGAGAACAACGACACTTAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-608s1c1
Sequence:CCGGCTAGACTGATTCCTGTGCTAACTCGAGTTAGCACAGGAATCAGTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-752s1c1
Sequence:CCGGGCCTTAGCATCATCAAATCTACTCGAGTAGATTTGATGATGCTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-184s1c1
Sequence:CCGGGCAACAGGTAACTATGATCAACTCGAGTTGATCATAGTTACCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145048.2-1050s1c1
Sequence:CCGGGCGAAGAACCATTATTGAGTTCTCGAGAACTCAATAATGGTTCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-237s1c1
Sequence:CCGGGAATGCAGTTCAGGGAAGCAACTCGAGTTGCTTCCCTGAACTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145048
VALIDATED
PACRGL MISSION shRNA Lentiviral Transduction Particles
PARK2 co-regulated-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-727s21c1
Sequence:CCGGATTTGATCCACTTCTTATTACCTCGAGGTAATAAGAAGTGGATCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145048.3-897s21c1
Sequence:CCGGATTCGGATGATGAAGTGTTTGCTCGAGCAAACACTTCATCATCCGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1107s21c1
Sequence:CCGGACTAACTGTGGGTACTCATTTCTCGAGAAATGAGTACCCACAGTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145048.3-1392s21c1
Sequence:CCGGTTTGTAGCTGTGCCCTTATTTCTCGAGAAATAAGGGCACAGCTACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-367s1c1
Sequence:CCGGCCTTCTGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-413s1c1
Sequence:CCGGGATTGGTACATGGTTCAGTAACTCGAGTTACTGAACCATGTACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-1500s1c1
Sequence:CCGGGACTTCCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-685s1c1
Sequence:CCGGGTTCAGCTAAGTGTCGTTGTTCTCGAGAACAACGACACTTAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-608s1c1
Sequence:CCGGCTAGACTGATTCCTGTGCTAACTCGAGTTAGCACAGGAATCAGTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-752s1c1
Sequence:CCGGGCCTTAGCATCATCAAATCTACTCGAGTAGATTTGATGATGCTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_145048.2-184s1c1
Sequence:CCGGGCAACAGGTAACTATGATCAACTCGAGTTGATCATAGTTACCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145048.2-1050s1c1
Sequence:CCGGGCGAAGAACCATTATTGAGTTCTCGAGAACTCAATAATGGTTCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145048.2-237s1c1
Sequence:CCGGGAATGCAGTTCAGGGAAGCAACTCGAGTTGCTTCCCTGAACTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025755
VALIDATED
PACRGL MISSION shRNA Bacterial Glycerol Stock
PARK2 co-regulated-like
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-282s21c1
Sequence:CCGGTCGTCCTCGGCCAAGTGATAACTCGAGTTATCACTTGGCCGAGGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-349s21c1
Sequence:CCGGCCTACTGCATTCGCAGCTATTCTCGAGAATAGCTGCGAATGCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-609s21c1
Sequence:CCGGGAAGGCAGCTCTAGTTCATTCCTCGAGGAATGAACTAGAGCTGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-943s21c1
Sequence:CCGGTTCCGACTCACGGCATCATTCCTCGAGGAATGATGCCGTGAGTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-161s21c1
Sequence:CCGGACAGAGCGACAGGTAGTAATGCTCGAGCATTACTACCTGTCGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-438s1c1
Sequence:CCGGCCCGCCTGAAATTCTTCCATTCTCGAGAATGGAAGAATTTCAGGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-803s1c1
Sequence:CCGGGCGGAAATGCAAGTCTTATCACTCGAGTGATAAGACTTGCATTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-704s1c1
Sequence:CCGGGCCATCTGAAACTTCTGCTTACTCGAGTAAGCAGAAGTTTCAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-951s1c1
Sequence:CCGGCACGGCATCATTCATTCATTACTCGAGTAATGAATGAATGATGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-801s1c1
Sequence:CCGGCGGCGGAAATGCAAGTCTTATCTCGAGATAAGACTTGCATTTCCGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025755.2-1260s1c1
Sequence:CCGGCGGAATGTGGAAATGTGTATTCTCGAGAATACACATTTCCACATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025755.2-811s1c1
Sequence:CCGGGCAAGTCTTATCATCATCAAACTCGAGTTTGATGATGATAAGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-463s1c1
Sequence:CCGGCCGCTTCTAATTACGTTAGCTCTCGAGAGCTAACGTAATTAGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-1258s1c1
Sequence:CCGGGCCGGAATGTGGAAATGTGTACTCGAGTACACATTTCCACATTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-395s1c1
Sequence:CCGGGATTGGTACATGGCTCAGTAACTCGAGTTACTGAGCCATGTACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-350s1c1
Sequence:CCGGCTACTGCATTCGCAGCTATTTCTCGAGAAATAGCTGCGAATGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025755
VALIDATED
PACRGL MISSION shRNA shRNA Plasmid DNA
PARK2 co-regulated-like
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-282s21c1
Sequence:CCGGTCGTCCTCGGCCAAGTGATAACTCGAGTTATCACTTGGCCGAGGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-349s21c1
Sequence:CCGGCCTACTGCATTCGCAGCTATTCTCGAGAATAGCTGCGAATGCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-609s21c1
Sequence:CCGGGAAGGCAGCTCTAGTTCATTCCTCGAGGAATGAACTAGAGCTGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-943s21c1
Sequence:CCGGTTCCGACTCACGGCATCATTCCTCGAGGAATGATGCCGTGAGTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-161s21c1
Sequence:CCGGACAGAGCGACAGGTAGTAATGCTCGAGCATTACTACCTGTCGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-438s1c1
Sequence:CCGGCCCGCCTGAAATTCTTCCATTCTCGAGAATGGAAGAATTTCAGGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-803s1c1
Sequence:CCGGGCGGAAATGCAAGTCTTATCACTCGAGTGATAAGACTTGCATTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-704s1c1
Sequence:CCGGGCCATCTGAAACTTCTGCTTACTCGAGTAAGCAGAAGTTTCAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-951s1c1
Sequence:CCGGCACGGCATCATTCATTCATTACTCGAGTAATGAATGAATGATGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-801s1c1
Sequence:CCGGCGGCGGAAATGCAAGTCTTATCTCGAGATAAGACTTGCATTTCCGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025755.2-1260s1c1
Sequence:CCGGCGGAATGTGGAAATGTGTATTCTCGAGAATACACATTTCCACATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025755.2-811s1c1
Sequence:CCGGGCAAGTCTTATCATCATCAAACTCGAGTTTGATGATGATAAGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-463s1c1
Sequence:CCGGCCGCTTCTAATTACGTTAGCTCTCGAGAGCTAACGTAATTAGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-1258s1c1
Sequence:CCGGGCCGGAATGTGGAAATGTGTACTCGAGTACACATTTCCACATTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-395s1c1
Sequence:CCGGGATTGGTACATGGCTCAGTAACTCGAGTTACTGAGCCATGTACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-350s1c1
Sequence:CCGGCTACTGCATTCGCAGCTATTTCTCGAGAAATAGCTGCGAATGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025755
VALIDATED
PACRGL MISSION shRNA Lentiviral Transduction Particles
PARK2 co-regulated-like
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-282s21c1
Sequence:CCGGTCGTCCTCGGCCAAGTGATAACTCGAGTTATCACTTGGCCGAGGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-349s21c1
Sequence:CCGGCCTACTGCATTCGCAGCTATTCTCGAGAATAGCTGCGAATGCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-609s21c1
Sequence:CCGGGAAGGCAGCTCTAGTTCATTCCTCGAGGAATGAACTAGAGCTGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025755.3-943s21c1
Sequence:CCGGTTCCGACTCACGGCATCATTCCTCGAGGAATGATGCCGTGAGTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025755.3-161s21c1
Sequence:CCGGACAGAGCGACAGGTAGTAATGCTCGAGCATTACTACCTGTCGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-438s1c1
Sequence:CCGGCCCGCCTGAAATTCTTCCATTCTCGAGAATGGAAGAATTTCAGGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-803s1c1
Sequence:CCGGGCGGAAATGCAAGTCTTATCACTCGAGTGATAAGACTTGCATTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-704s1c1
Sequence:CCGGGCCATCTGAAACTTCTGCTTACTCGAGTAAGCAGAAGTTTCAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-951s1c1
Sequence:CCGGCACGGCATCATTCATTCATTACTCGAGTAATGAATGAATGATGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025755.2-801s1c1
Sequence:CCGGCGGCGGAAATGCAAGTCTTATCTCGAGATAAGACTTGCATTTCCGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025755.2-1260s1c1
Sequence:CCGGCGGAATGTGGAAATGTGTATTCTCGAGAATACACATTTCCACATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025755.2-811s1c1
Sequence:CCGGGCAAGTCTTATCATCATCAAACTCGAGTTTGATGATGATAAGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-463s1c1
Sequence:CCGGCCGCTTCTAATTACGTTAGCTCTCGAGAGCTAACGTAATTAGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025755.2-1258s1c1
Sequence:CCGGGCCGGAATGTGGAAATGTGTACTCGAGTACACATTTCCACATTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-395s1c1
Sequence:CCGGGATTGGTACATGGCTCAGTAACTCGAGTTACTGAGCCATGTACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025755.2-350s1c1
Sequence:CCGGCTACTGCATTCGCAGCTATTTCTCGAGAAATAGCTGCGAATGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)