EMAIL THIS PAGE TO A FRIEND

PACS1

phosphofurin acidic cluster sorting protein 1

54 Gene Product Result for
Synonyms: MRD17
Gene ID:
Human(55690) Summary: This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Mouse(107975) phosphofurin acidic cluster sorting protein 1
Rat(171444) phosphofurin acidic cluster sorting protein 1
naked mole-rat(101701857) phosphofurin acidic cluster sorting protein 1
domestic guinea pig(100727661) phosphofurin acidic cluster sorting protein 1
sheep(101104443) phosphofurin acidic cluster sorting protein 1
chicken(421254) phosphofurin acidic cluster sorting protein 1
cow(514313) phosphofurin acidic cluster sorting protein 1
domestic cat(101098825) phosphofurin acidic cluster sorting protein 1
dog(483716) phosphofurin acidic cluster sorting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038914 Anti-PACS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021531 MISSION® esiRNA esiRNA human PACS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018026 Rosetta Predictions human pricing
NM_134406 Rosetta Predictions rat pricing
NM_153129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351127 predicted 1473
2 SASI_Hs01_00073091 predicted 2336
3 SASI_Hs01_00073092 predicted 670
4 SASI_Hs01_00073093 predicted 2678
5 SASI_Hs01_00073094 predicted 2827
6 SASI_Hs01_00073095 predicted 1001
7 SASI_Hs01_00073096 predicted 1689
8 SASI_Hs01_00073097 predicted 920
9 SASI_Hs01_00073098 predicted 2447
10 SASI_Hs01_00073099 predicted 943
11 SASI_Hs01_00073090 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064783 predicted 1378
2 SASI_Rn01_00064784 predicted 1715
3 SASI_Rn01_00064785 predicted 2632
4 SASI_Rn01_00064787 predicted 1446
5 SASI_Rn02_00268000 predicted 656
6 SASI_Rn01_00064788 predicted 1403
7 SASI_Rn01_00064789 predicted 1822
8 SASI_Rn01_00064790 predicted 562
9 SASI_Rn01_00064791 predicted 2852
10 SASI_Rn02_00268001 predicted 1497
11 SASI_Rn01_00064782 predicted 1734
12 SASI_Rn01_00064786 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149582 predicted 1235
2 SASI_Mm01_00149583 predicted 2413
3 SASI_Mm02_00343001 predicted 1854
4 SASI_Mm01_00149584 predicted 1853
5 SASI_Mm01_00149586 predicted 787
6 SASI_Mm01_00149587 predicted 1535
7 SASI_Mm01_00149588 predicted 814
8 SASI_Mm01_00149589 predicted 3059
9 SASI_Mm01_00149590 predicted 1199
10 SASI_Mm01_00149591 predicted 1610
11 SASI_Mm01_00149585 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018026
VALIDATED
PACS1 MISSION shRNA Bacterial Glycerol Stock
phosphofurin acidic cluster sorting protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1161s1c1
Sequence:CCGGGTTTCAGATGAGGTGGGCTTTCTCGAGAAAGCCCACCTCATCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3353s1c1
Sequence:CCGGCCTTGTGGTATCAGTTTCCTTCTCGAGAAGGAAACTGATACCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1760s1c1
Sequence:CCGGGATTCCAAGAAAGGTGGTGTACTCGAGTACACCACCTTTCTTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3336s1c1
Sequence:CCGGCCGACTTCCAAACTCTTCCTTCTCGAGAAGGAAGAGTTTGGAAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2331s1c1
Sequence:CCGGCGGCATAAGTTCCCTGATGAACTCGAGTTCATCAGGGAACTTATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-1425s1c1
Sequence:CCGGCCTATGGAATTGGCTGCTCTACTCGAGTAGAGCAGCCAATTCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-792s1c1
Sequence:CCGGGAGGTGATGCAGCATCCTAATCTCGAGATTAGGATGCTGCATCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1757s1c1
Sequence:CCGGGCAGATTCCAAGAAAGGTGGTCTCGAGACCACCTTTCTTGGAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2783s1c1
Sequence:CCGGCAAGAAAGTTCCCACCATCTTCTCGAGAAGATGGTGGGAACTTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-2930s1c1
Sequence:CCGGGTGGAGTGACATCAAGTTCTTCTCGAGAAGAACTTGATGTCACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1151s1c1
Sequence:CCGGGCGGTTTAAAGTTTCAGATGACTCGAGTCATCTGAAACTTTAAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018026
VALIDATED
PACS1 MISSION shRNA shRNA Plasmid DNA
phosphofurin acidic cluster sorting protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1161s1c1
Sequence:CCGGGTTTCAGATGAGGTGGGCTTTCTCGAGAAAGCCCACCTCATCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3353s1c1
Sequence:CCGGCCTTGTGGTATCAGTTTCCTTCTCGAGAAGGAAACTGATACCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1760s1c1
Sequence:CCGGGATTCCAAGAAAGGTGGTGTACTCGAGTACACCACCTTTCTTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3336s1c1
Sequence:CCGGCCGACTTCCAAACTCTTCCTTCTCGAGAAGGAAGAGTTTGGAAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2331s1c1
Sequence:CCGGCGGCATAAGTTCCCTGATGAACTCGAGTTCATCAGGGAACTTATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-1425s1c1
Sequence:CCGGCCTATGGAATTGGCTGCTCTACTCGAGTAGAGCAGCCAATTCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-792s1c1
Sequence:CCGGGAGGTGATGCAGCATCCTAATCTCGAGATTAGGATGCTGCATCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1757s1c1
Sequence:CCGGGCAGATTCCAAGAAAGGTGGTCTCGAGACCACCTTTCTTGGAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2783s1c1
Sequence:CCGGCAAGAAAGTTCCCACCATCTTCTCGAGAAGATGGTGGGAACTTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-2930s1c1
Sequence:CCGGGTGGAGTGACATCAAGTTCTTCTCGAGAAGAACTTGATGTCACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1151s1c1
Sequence:CCGGGCGGTTTAAAGTTTCAGATGACTCGAGTCATCTGAAACTTTAAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018026
VALIDATED
PACS1 MISSION shRNA Lentiviral Transduction Particles
phosphofurin acidic cluster sorting protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1161s1c1
Sequence:CCGGGTTTCAGATGAGGTGGGCTTTCTCGAGAAAGCCCACCTCATCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3353s1c1
Sequence:CCGGCCTTGTGGTATCAGTTTCCTTCTCGAGAAGGAAACTGATACCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1760s1c1
Sequence:CCGGGATTCCAAGAAAGGTGGTGTACTCGAGTACACCACCTTTCTTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-3336s1c1
Sequence:CCGGCCGACTTCCAAACTCTTCCTTCTCGAGAAGGAAGAGTTTGGAAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2331s1c1
Sequence:CCGGCGGCATAAGTTCCCTGATGAACTCGAGTTCATCAGGGAACTTATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-1425s1c1
Sequence:CCGGCCTATGGAATTGGCTGCTCTACTCGAGTAGAGCAGCCAATTCCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-792s1c1
Sequence:CCGGGAGGTGATGCAGCATCCTAATCTCGAGATTAGGATGCTGCATCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1757s1c1
Sequence:CCGGGCAGATTCCAAGAAAGGTGGTCTCGAGACCACCTTTCTTGGAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-2783s1c1
Sequence:CCGGCAAGAAAGTTCCCACCATCTTCTCGAGAAGATGGTGGGAACTTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018026.2-2930s1c1
Sequence:CCGGGTGGAGTGACATCAAGTTCTTCTCGAGAAGAACTTGATGTCACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018026.2-1151s1c1
Sequence:CCGGGCGGTTTAAAGTTTCAGATGACTCGAGTCATCTGAAACTTTAAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153129
VALIDATED
PACS1 MISSION shRNA Bacterial Glycerol Stock
phosphofurin acidic cluster sorting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-896s21c1
Sequence:CCGGACCCTAATGAGGGCGCTTTAGCTCGAGCTAAAGCGCCCTCATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-1231s21c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153129.2-3357s21c1
Sequence:CCGGGTACCCATAATCCCTGTAATTCTCGAGAATTACAGGGATTATGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-1231s1c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153129.2-3639s1c1
Sequence:CCGGCCCGGTATTTCTGGGATTGAACTCGAGTTCAATCCCAGAAATACCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-2724s21c1
Sequence:CCGGGCGAAGGAGAGAAGGTGATAACTCGAGTTATCACCTTCTCTCCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-3806s1c1
Sequence:CCGGCCTAAGATTGTTCTGTGGCTTCTCGAGAAGCCACAGAACAATCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-832s21c1
Sequence:CCGGCGAACTATCTTGGGCTATAAACTCGAGTTTATAGCCCAAGATAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153129.2-3060s1c1
Sequence:CCGGGCCAACTCATGTCAAGCACTTCTCGAGAAGTGCTTGACATGAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153129
VALIDATED
PACS1 MISSION shRNA shRNA Plasmid DNA
phosphofurin acidic cluster sorting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-896s21c1
Sequence:CCGGACCCTAATGAGGGCGCTTTAGCTCGAGCTAAAGCGCCCTCATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-1231s21c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153129.2-3357s21c1
Sequence:CCGGGTACCCATAATCCCTGTAATTCTCGAGAATTACAGGGATTATGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-1231s1c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153129.2-3639s1c1
Sequence:CCGGCCCGGTATTTCTGGGATTGAACTCGAGTTCAATCCCAGAAATACCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-2724s21c1
Sequence:CCGGGCGAAGGAGAGAAGGTGATAACTCGAGTTATCACCTTCTCTCCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-3806s1c1
Sequence:CCGGCCTAAGATTGTTCTGTGGCTTCTCGAGAAGCCACAGAACAATCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-832s21c1
Sequence:CCGGCGAACTATCTTGGGCTATAAACTCGAGTTTATAGCCCAAGATAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153129.2-3060s1c1
Sequence:CCGGGCCAACTCATGTCAAGCACTTCTCGAGAAGTGCTTGACATGAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153129
VALIDATED
PACS1 MISSION shRNA Lentiviral Transduction Particles
phosphofurin acidic cluster sorting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-896s21c1
Sequence:CCGGACCCTAATGAGGGCGCTTTAGCTCGAGCTAAAGCGCCCTCATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-1231s21c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153129.2-3357s21c1
Sequence:CCGGGTACCCATAATCCCTGTAATTCTCGAGAATTACAGGGATTATGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-1231s1c1
Sequence:CCGGGCCCTCCTGAAACGATTCAAACTCGAGTTTGAATCGTTTCAGGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153129.2-3639s1c1
Sequence:CCGGCCCGGTATTTCTGGGATTGAACTCGAGTTCAATCCCAGAAATACCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-2724s21c1
Sequence:CCGGGCGAAGGAGAGAAGGTGATAACTCGAGTTATCACCTTCTCTCCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153129.2-3806s1c1
Sequence:CCGGCCTAAGATTGTTCTGTGGCTTCTCGAGAAGCCACAGAACAATCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153129.2-832s21c1
Sequence:CCGGCGAACTATCTTGGGCTATAAACTCGAGTTTATAGCCCAAGATAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153129.2-3060s1c1
Sequence:CCGGGCCAACTCATGTCAAGCACTTCTCGAGAAGTGCTTGACATGAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)