EMAIL THIS PAGE TO A FRIEND

PACS2

phosphofurin acidic cluster sorting protein 2

120 Gene Product Result for
Synonyms: PACS-2 PACS1L
UniProtKB ID: Q86VP3, A2VDJ9, O60342, Q6P191, Q96FL7
Gene ID:
Mouse(217893) phosphofurin acidic cluster sorting protein 2
Rat(691631) phosphofurin acidic cluster sorting protein 2
Zebrafish(794778) phosphofurin acidic cluster sorting protein 2
chicken(424375) phosphofurin acidic cluster sorting protein 2
cow(100299595) phosphofurin acidic cluster sorting protein 2
domestic cat(101089702) phosphofurin acidic cluster sorting protein 2
dog(490884) phosphofurin acidic cluster sorting protein 2
sheep(101106466) phosphofurin acidic cluster sorting protein 2
domestic guinea pig(100731250) phosphofurin acidic cluster sorting protein 2
naked mole-rat(101722600) phosphofurin acidic cluster sorting protein 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100913 Rosetta Predictions human pricing
NM_015197 Rosetta Predictions human pricing
NM_001081170 Rosetta Predictions mouse pricing
XM_203601 Rosetta Predictions mouse pricing
XM_884954 Rosetta Predictions mouse pricing
XM_895864 Rosetta Predictions mouse pricing
XM_895876 Rosetta Predictions mouse pricing
XM_895885 Rosetta Predictions mouse pricing
XM_895895 Rosetta Predictions mouse pricing
XM_895920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322515 predicted 2622
2 SASI_Hs02_00322516 predicted 489
3 SASI_Hs02_00322517 predicted 2070
4 SASI_Hs02_00322518 predicted 2656
5 SASI_Hs02_00322519 predicted 911
6 SASI_Hs02_00322520 predicted 1790
7 SASI_Hs02_00322521 predicted 468
8 SASI_Hs02_00322522 predicted 1169
9 SASI_Hs02_00322523 predicted 2507
10 SASI_Hs02_00322524 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347267 predicted 2604
2 SASI_Hs01_00157026 predicted 494
3 SASI_Hs01_00157027 predicted 2064
4 SASI_Hs02_00347268 predicted 2649
5 SASI_Hs02_00347269 predicted 909
6 SASI_Hs02_00347270 predicted 1773
7 SASI_Hs02_00347271 predicted 471
8 SASI_Hs02_00347272 predicted 1174
9 SASI_Hs02_00347273 predicted 2495
10 SASI_Hs02_00347274 predicted 948
11 SASI_Hs01_00157021 predicted 1955
12 SASI_Hs01_00157022 predicted 2113
13 SASI_Hs01_00157023 predicted 2104
14 SASI_Hs01_00157024 predicted 1458
15 SASI_Hs01_00157025 predicted 2488
16 SASI_Hs01_00157028 predicted 1499
17 SASI_Hs01_00157029 predicted 2086
18 SASI_Hs01_00157030 predicted 1915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295871 predicted 377
2 SASI_Mm02_00295872 predicted 1644
3 SASI_Mm02_00295873 predicted 1046
4 SASI_Mm02_00295874 predicted 272
5 SASI_Mm02_00295875 predicted 1244
6 SASI_Mm02_00295876 predicted 1947
7 SASI_Mm02_00295877 predicted 1517
8 SASI_Mm02_00295878 predicted 2387
9 SASI_Mm02_00295879 predicted 2042
10 SASI_Mm02_00295880 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267532 predicted 3008
2 SASI_Mm01_00267533 predicted 2849
3 SASI_Mm01_00267534 predicted 2536
4 SASI_Mm01_00267535 predicted 2590
5 SASI_Mm01_00267536 predicted 2861
6 SASI_Mm01_00267537 predicted 2913
7 SASI_Mm01_00267538 predicted 1952
8 SASI_Mm01_00267539 predicted 2932
9 SASI_Mm01_00267540 predicted 2971
10 SASI_Mm01_00267541 predicted 2854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221081 predicted 2898
2 SASI_Mm01_00221082 predicted 2737
3 SASI_Mm01_00221083 predicted 2420
4 SASI_Mm01_00221084 predicted 2474
5 SASI_Mm01_00221085 predicted 2747
6 SASI_Mm01_00221086 predicted 2790
7 SASI_Mm01_00221087 predicted 1835
8 SASI_Mm01_00221088 predicted 2823
9 SASI_Mm01_00221089 predicted 2866
10 SASI_Mm01_00221090 predicted 2733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203664 predicted 384
2 SASI_Mm01_00203665 predicted 1642
3 SASI_Mm01_00203666 predicted 2532
4 SASI_Mm01_00203667 predicted 1055
5 SASI_Mm01_00203668 predicted 2585
6 SASI_Mm01_00203669 predicted 280
7 SASI_Mm01_00203670 predicted 1254
8 SASI_Mm01_00203671 predicted 1953
9 SASI_Mm01_00203672 predicted 1520
10 SASI_Mm01_00203673 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210032 predicted 2843
2 SASI_Mm01_00210033 predicted 2790
3 SASI_Mm01_00210034 predicted 2884
4 SASI_Mm01_00210035 predicted 3038
5 SASI_Mm01_00210036 predicted 3038
6 SASI_Mm01_00210037 predicted 2924
7 SASI_Mm01_00210038 predicted 2855
8 SASI_Mm01_00210039 predicted 2904
9 SASI_Mm01_00210040 predicted 3220
10 SASI_Mm01_00210041 predicted 3132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261043 predicted 1581
2 SASI_Mm01_00261044 predicted 1420
3 SASI_Mm01_00261045 predicted 1105
4 SASI_Mm01_00261046 predicted 1161
5 SASI_Mm01_00261047 predicted 1430
6 SASI_Mm01_00261048 predicted 1481
7 SASI_Mm01_00261049 predicted 522
8 SASI_Mm01_00261050 predicted 1508
9 SASI_Mm01_00261051 predicted 1550
10 SASI_Mm01_00261052 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207234 predicted 2981
2 SASI_Mm01_00207235 predicted 2824
3 SASI_Mm01_00207236 predicted 2512
4 SASI_Mm01_00207237 predicted 2558
5 SASI_Mm01_00207238 predicted 2832
6 SASI_Mm01_00207239 predicted 2882
7 SASI_Mm01_00207240 predicted 1924
8 SASI_Mm01_00207241 predicted 2914
9 SASI_Mm01_00207242 predicted 2947
10 SASI_Mm01_00207243 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259798 predicted 3085
2 SASI_Mm01_00259799 predicted 2930
3 SASI_Mm01_00259800 predicted 2616
4 SASI_Mm01_00259801 predicted 2665
5 SASI_Mm01_00259802 predicted 2935
6 SASI_Mm01_00259803 predicted 2987
7 SASI_Mm01_00259804 predicted 2037
8 SASI_Mm01_00259805 predicted 3021
9 SASI_Mm01_00259806 predicted 3061
10 SASI_Mm01_00259807 predicted 2925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081170
VALIDATED
PACS2 MISSION shRNA Bacterial Glycerol Stock
phosphofurin acidic cluster sorting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081170.1-4196s21c1
Sequence:CCGGTTGCTGAACAGGGTCTATTTGCTCGAGCAAATAGACCCTGTTCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081170.1-1320s21c1
Sequence:CCGGTCCACCAGGTCAGAATCAAAGCTCGAGCTTTGATTCTGACCTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-718s21c1
Sequence:CCGGATCTTGACGAGGACGACTTTGCTCGAGCAAAGTCGTCCTCGTCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-1666s21c1
Sequence:CCGGAGCGATACTGCAACTGCAATTCTCGAGAATTGCAGTTGCAGTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-277s21c1
Sequence:CCGGTCTTGAGATCACATGAGATTGCTCGAGCAATCTCATGTGATCTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081170
VALIDATED
PACS2 MISSION shRNA shRNA Plasmid DNA
phosphofurin acidic cluster sorting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081170.1-4196s21c1
Sequence:CCGGTTGCTGAACAGGGTCTATTTGCTCGAGCAAATAGACCCTGTTCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081170.1-1320s21c1
Sequence:CCGGTCCACCAGGTCAGAATCAAAGCTCGAGCTTTGATTCTGACCTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-718s21c1
Sequence:CCGGATCTTGACGAGGACGACTTTGCTCGAGCAAAGTCGTCCTCGTCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-1666s21c1
Sequence:CCGGAGCGATACTGCAACTGCAATTCTCGAGAATTGCAGTTGCAGTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-277s21c1
Sequence:CCGGTCTTGAGATCACATGAGATTGCTCGAGCAATCTCATGTGATCTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081170
VALIDATED
PACS2 MISSION shRNA Lentiviral Transduction Particles
phosphofurin acidic cluster sorting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081170.1-4196s21c1
Sequence:CCGGTTGCTGAACAGGGTCTATTTGCTCGAGCAAATAGACCCTGTTCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081170.1-1320s21c1
Sequence:CCGGTCCACCAGGTCAGAATCAAAGCTCGAGCTTTGATTCTGACCTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-718s21c1
Sequence:CCGGATCTTGACGAGGACGACTTTGCTCGAGCAAAGTCGTCCTCGTCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-1666s21c1
Sequence:CCGGAGCGATACTGCAACTGCAATTCTCGAGAATTGCAGTTGCAGTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081170.1-277s21c1
Sequence:CCGGTCTTGAGATCACATGAGATTGCTCGAGCAATCTCATGTGATCTCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015197
PACS2 MISSION shRNA Bacterial Glycerol Stock
phosphofurin acidic cluster sorting protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1238s1c1
Sequence:CCGGGACCAGGCAACAGAACTTCAACTCGAGTTGAAGTTCTGTTGCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1217s1c1
Sequence:CCGGGATTGTAAGAACGACGTCCATCTCGAGATGGACGTCGTTCTTACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2927s1c1
Sequence:CCGGGAAGAACAAGAAGGTGATGTTCTCGAGAACATCACCTTCTTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2918s1c1
Sequence:CCGGCACCAAGGAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTCCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015197.1-1244s1c1
Sequence:CCGGGCAACAGAACTTCAAGCAGAACTCGAGTTCTGCTTGAAGTTCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015197
PACS2 MISSION shRNA shRNA Plasmid DNA
phosphofurin acidic cluster sorting protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1238s1c1
Sequence:CCGGGACCAGGCAACAGAACTTCAACTCGAGTTGAAGTTCTGTTGCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1217s1c1
Sequence:CCGGGATTGTAAGAACGACGTCCATCTCGAGATGGACGTCGTTCTTACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2927s1c1
Sequence:CCGGGAAGAACAAGAAGGTGATGTTCTCGAGAACATCACCTTCTTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2918s1c1
Sequence:CCGGCACCAAGGAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTCCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015197.1-1244s1c1
Sequence:CCGGGCAACAGAACTTCAAGCAGAACTCGAGTTCTGCTTGAAGTTCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015197
PACS2 MISSION shRNA Lentiviral Transduction Particles
phosphofurin acidic cluster sorting protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1238s1c1
Sequence:CCGGGACCAGGCAACAGAACTTCAACTCGAGTTGAAGTTCTGTTGCCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-1217s1c1
Sequence:CCGGGATTGTAAGAACGACGTCCATCTCGAGATGGACGTCGTTCTTACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2927s1c1
Sequence:CCGGGAAGAACAAGAAGGTGATGTTCTCGAGAACATCACCTTCTTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015197.1-2918s1c1
Sequence:CCGGCACCAAGGAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTCCTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015197.1-1244s1c1
Sequence:CCGGGCAACAGAACTTCAAGCAGAACTCGAGTTCTGCTTGAAGTTCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)