EMAIL THIS PAGE TO A FRIEND

PACSIN1

protein kinase C and casein kinase substrate in neurons 1

116 Gene Product Result for
Synonyms: SDPI
UniProtKB ID: Q9BY11, Q9P2G8
Gene ID:
Mouse(23969) protein kinase C and casein kinase substrate in neurons 1
Rat(29704) protein kinase C and casein kinase substrate in neurons 1
naked mole-rat(101699093) protein kinase C and casein kinase substrate in neurons 1
domestic guinea pig(100726771) protein kinase C and casein kinase substrate in neurons 1
Goat(100860994) protein kinase C and casein kinase substrate in neurons 1
sheep(101119942) protein kinase C and casein kinase substrate in neurons 1
chicken(419903) protein kinase C and casein kinase substrate in neurons 1
domestic cat(101095898) protein kinase C and casein kinase substrate in neurons 1
cow(520488) protein kinase C and casein kinase substrate in neurons 1
Horse(100062613) protein kinase C and casein kinase substrate in neurons 1
dog(608087) protein kinase C and casein kinase substrate in neurons 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABS39 Anti-phospho-PACSIN1/Syndapin 1 (Ser346) Antibody | ABS39 pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020804 Rosetta Predictions human pricing
NM_017294 Rosetta Predictions rat pricing
NM_011861 Rosetta Predictions mouse pricing
NM_178365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111432 predicted 212
2 SASI_Hs01_00111433 predicted 970
3 SASI_Hs01_00111434 predicted 575
4 SASI_Hs02_00353979 predicted 506
5 SASI_Hs01_00111436 predicted 1046
6 SASI_Hs01_00111437 predicted 1055
7 SASI_Hs01_00111439 predicted 1280
8 SASI_Hs01_00111440 predicted 543
9 SASI_Hs01_00111441 predicted 605
10 SASI_Hs02_00353980 predicted 775
11 SASI_Hs01_00111435 predicted 1133
12 SASI_Hs01_00111438 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087868 predicted 708
2 SASI_Rn01_00087869 predicted 876
3 SASI_Rn01_00087870 predicted 933
4 SASI_Rn01_00087871 predicted 805
5 SASI_Rn01_00087872 predicted 510
6 SASI_Rn01_00087873 predicted 443
7 SASI_Rn01_00087874 predicted 1219
8 SASI_Rn01_00087875 predicted 615
9 SASI_Rn01_00087876 predicted 926
10 SASI_Rn01_00087877 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321620 predicted 658
2 SASI_Mm02_00321621 predicted 653
3 SASI_Mm01_00147662 predicted 1265
4 SASI_Mm01_00147663 predicted 1034
5 SASI_Mm02_00321622 predicted 920
6 SASI_Mm02_00321623 predicted 830
7 SASI_Mm02_00321624 predicted 965
8 SASI_Mm02_00321625 predicted 972
9 SASI_Mm01_00147664 predicted 555
10 SASI_Mm01_00147665 predicted 1227
11 SASI_Mm01_00147666 predicted 341
12 SASI_Mm01_00147667 predicted 457
13 SASI_Mm01_00147668 predicted 1276
14 SASI_Mm01_00147669 predicted 1041
15 SASI_Mm01_00147670 predicted 338
16 SASI_Mm01_00147671 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348752 predicted 752
2 SASI_Mm02_00348753 predicted 745
3 SASI_Mm01_00106757 predicted 1358
4 SASI_Mm01_00106758 predicted 1127
5 SASI_Mm02_00348754 predicted 1021
6 SASI_Mm02_00348755 predicted 928
7 SASI_Mm02_00348756 predicted 1068
8 SASI_Mm02_00348757 predicted 1071
9 SASI_Mm01_00106759 predicted 648
10 SASI_Mm01_00106760 predicted 1326
11 SASI_Mm01_00106761 predicted 437
12 SASI_Mm01_00106762 predicted 555
13 SASI_Mm01_00106763 predicted 1371
14 SASI_Mm01_00106764 predicted 1134
15 SASI_Mm01_00106765 predicted 431
16 SASI_Mm01_00106766 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020804
PACSIN1 MISSION shRNA Bacterial Glycerol Stock
protein kinase C and casein kinase substrate in neurons 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-563s1c1
Sequence:CCGGCGCCTATCACAAGCAGATCATCTCGAGATGATCTGCTTGTGATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-1238s1c1
Sequence:CCGGCGGCAGTGTTAGCAGCTACGACTCGAGTCGTAGCTGCTAACACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-809s1c1
Sequence:CCGGTGTGCAGAAGACACAGGAGAACTCGAGTTCTCCTGTGTCTTCTGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-730s21c1
Sequence:CCGGTGAACAGCAAGACGGAGCAATCTCGAGATTGCTCCGTCTTGCTGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-314s21c1
Sequence:CCGGCCGTCTATGCAACGACCTGATCTCGAGATCAGGTCGTTGCATAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020804
PACSIN1 MISSION shRNA shRNA Plasmid DNA
protein kinase C and casein kinase substrate in neurons 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-563s1c1
Sequence:CCGGCGCCTATCACAAGCAGATCATCTCGAGATGATCTGCTTGTGATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-1238s1c1
Sequence:CCGGCGGCAGTGTTAGCAGCTACGACTCGAGTCGTAGCTGCTAACACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-809s1c1
Sequence:CCGGTGTGCAGAAGACACAGGAGAACTCGAGTTCTCCTGTGTCTTCTGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-730s21c1
Sequence:CCGGTGAACAGCAAGACGGAGCAATCTCGAGATTGCTCCGTCTTGCTGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-314s21c1
Sequence:CCGGCCGTCTATGCAACGACCTGATCTCGAGATCAGGTCGTTGCATAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020804
PACSIN1 MISSION shRNA Lentiviral Transduction Particles
protein kinase C and casein kinase substrate in neurons 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-563s1c1
Sequence:CCGGCGCCTATCACAAGCAGATCATCTCGAGATGATCTGCTTGTGATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-1238s1c1
Sequence:CCGGCGGCAGTGTTAGCAGCTACGACTCGAGTCGTAGCTGCTAACACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020804.1-809s1c1
Sequence:CCGGTGTGCAGAAGACACAGGAGAACTCGAGTTCTCCTGTGTCTTCTGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-730s21c1
Sequence:CCGGTGAACAGCAAGACGGAGCAATCTCGAGATTGCTCCGTCTTGCTGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020804.2-314s21c1
Sequence:CCGGCCGTCTATGCAACGACCTGATCTCGAGATCAGGTCGTTGCATAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011861
PACSIN1 MISSION shRNA Bacterial Glycerol Stock
protein kinase C and casein kinase substrate in neurons 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011861.1-1590s1c1
Sequence:CCGGGCCATAGAGTTCCAGACATATCTCGAGATATGTCTGGAACTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1502s1c1
Sequence:CCGGGCCAACTACGTTGAGGCTATACTCGAGTATAGCCTCAACGTAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-400s1c1
Sequence:CCGGCATCGAGAAAGGTCCTCAGTACTCGAGTACTGAGGACCTTTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1220s1c1
Sequence:CCGGCGTGGCAGTGTTAGCAGCTATCTCGAGATAGCTGCTAACACTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-761s1c1
Sequence:CCGGCTTGTGGACAAAGTGGACAAACTCGAGTTTGTCCACTTTGTCCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1238s21c1
Sequence:CCGGTATGACCGAGGCCAAACATATCTCGAGATATGTTTGGCCTCGGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1504s21c1
Sequence:CCGGCAACTACGTTGAGGCTATATACTCGAGTATATAGCCTCAACGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1353s21c1
Sequence:CCGGTTCGTGTACGGGCACTCTATGCTCGAGCATAGAGTGCCCGTACACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011861
PACSIN1 MISSION shRNA shRNA Plasmid DNA
protein kinase C and casein kinase substrate in neurons 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011861.1-1590s1c1
Sequence:CCGGGCCATAGAGTTCCAGACATATCTCGAGATATGTCTGGAACTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1502s1c1
Sequence:CCGGGCCAACTACGTTGAGGCTATACTCGAGTATAGCCTCAACGTAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-400s1c1
Sequence:CCGGCATCGAGAAAGGTCCTCAGTACTCGAGTACTGAGGACCTTTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1220s1c1
Sequence:CCGGCGTGGCAGTGTTAGCAGCTATCTCGAGATAGCTGCTAACACTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-761s1c1
Sequence:CCGGCTTGTGGACAAAGTGGACAAACTCGAGTTTGTCCACTTTGTCCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1238s21c1
Sequence:CCGGTATGACCGAGGCCAAACATATCTCGAGATATGTTTGGCCTCGGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1504s21c1
Sequence:CCGGCAACTACGTTGAGGCTATATACTCGAGTATATAGCCTCAACGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1353s21c1
Sequence:CCGGTTCGTGTACGGGCACTCTATGCTCGAGCATAGAGTGCCCGTACACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011861
PACSIN1 MISSION shRNA Lentiviral Transduction Particles
protein kinase C and casein kinase substrate in neurons 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011861.1-1590s1c1
Sequence:CCGGGCCATAGAGTTCCAGACATATCTCGAGATATGTCTGGAACTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1502s1c1
Sequence:CCGGGCCAACTACGTTGAGGCTATACTCGAGTATAGCCTCAACGTAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-400s1c1
Sequence:CCGGCATCGAGAAAGGTCCTCAGTACTCGAGTACTGAGGACCTTTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-1220s1c1
Sequence:CCGGCGTGGCAGTGTTAGCAGCTATCTCGAGATAGCTGCTAACACTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011861.1-761s1c1
Sequence:CCGGCTTGTGGACAAAGTGGACAAACTCGAGTTTGTCCACTTTGTCCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1238s21c1
Sequence:CCGGTATGACCGAGGCCAAACATATCTCGAGATATGTTTGGCCTCGGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1504s21c1
Sequence:CCGGCAACTACGTTGAGGCTATATACTCGAGTATATAGCCTCAACGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011861.2-1353s21c1
Sequence:CCGGTTCGTGTACGGGCACTCTATGCTCGAGCATAGAGTGCCCGTACACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)