EMAIL THIS PAGE TO A FRIEND

PADI1

peptidyl arginine deiminase, type I

87 Gene Product Result for
Synonyms: HPAD10 PAD1 PDI PDI1
UniProtKB ID: Q9ULC6, A1L4K6, Q70SX6
Gene ID:
Human(29943) Summary: This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Mouse(18599) peptidyl arginine deiminase, type I
Rat(54282) peptidyl arginine deiminase, type I
sheep(101108201) peptidyl arginine deiminase, type I
domestic guinea pig(100728246) peptidyl arginine deiminase, type I
naked mole-rat(101722077) peptidyl arginine deiminase, type I
chicken(428171) peptidyl arginine deiminase, type I
cow(618224) peptidyl arginine deiminase, type I
Horse(100049961) peptidyl arginine deiminase, type I
domestic cat(101085557) peptidyl arginine deiminase, type I
dog(608443) peptidyl arginine deiminase, type I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016251 MISSION® esiRNA esiRNA targeting human PADI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013358 Rosetta Predictions human pricing
NM_019332 Rosetta Predictions rat pricing
NM_011059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070692 predicted 1724
2 SASI_Hs01_00070694 predicted 306
3 SASI_Hs01_00070695 predicted 1519
4 SASI_Hs01_00070696 predicted 337
5 SASI_Hs02_00344689 predicted 1723
6 SASI_Hs01_00070697 predicted 1703
7 SASI_Hs01_00070698 predicted 864
8 SASI_Hs01_00070699 predicted 1840
9 SASI_Hs01_00070700 predicted 334
10 SASI_Hs01_00070701 predicted 1000
11 SASI_Hs01_00070693 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066950 predicted 2048
2 SASI_Rn01_00066951 predicted 1693
3 SASI_Rn02_00262311 predicted 2086
4 SASI_Rn01_00066952 predicted 400
5 SASI_Rn01_00066954 predicted 380
6 SASI_Rn01_00066955 predicted 2061
7 SASI_Rn01_00066956 predicted 1241
8 SASI_Rn01_00066957 predicted 1408
9 SASI_Rn01_00066958 predicted 826
10 SASI_Rn01_00066959 predicted 1870
11 SASI_Rn01_00066953 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052723 predicted 455
2 SASI_Mm01_00052724 predicted 825
3 SASI_Mm02_00319815 predicted 1039
4 SASI_Mm01_00052726 predicted 571
5 SASI_Mm01_00052728 predicted 1204
6 SASI_Mm01_00052729 predicted 571
7 SASI_Mm01_00052730 predicted 2197
8 SASI_Mm01_00052731 predicted 1189
9 SASI_Mm02_00319816 predicted 965
10 SASI_Mm02_00319817 predicted 1874
11 SASI_Mm01_00052722 predicted 718
12 SASI_Mm01_00052725 predicted 2008
13 SASI_Mm01_00052727 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013358
PADI1 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-364s21c1
Sequence:CCGGAGGTGAGGGTCTCCTACTTTGCTCGAGCAAAGTAGGAGACCCTCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013358.2-2328s21c1
Sequence:CCGGAGAGGCTCTAGATCAACAATGCTCGAGCATTGTTGATCTAGAGCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-424s21c1
Sequence:CCGGACCTCACTGGCGTCGATATTTCTCGAGAAATATCGACGCCAGTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-1603s21c1
Sequence:CCGGAGAAGAAAGAAGAGGGTTATGCTCGAGCATAACCCTCTTCTTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1246s1c1
Sequence:CCGGGTCCTGACTTTGGATATGTTACTCGAGTAACATATCCAAAGTCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1767s1c1
Sequence:CCGGGAGAGTGACATCGTGGACATTCTCGAGAATGTCCACGATGTCACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-325s1c1
Sequence:CCGGGCACAGCCAGTAAGGAATTAACTCGAGTTAATTCCTTACTGGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1698s1c1
Sequence:CCGGGACAATCTTCATGCACAGAAACTCGAGTTTCTGTGCATGAAGATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-678s1c1
Sequence:CCGGCTTGTCTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013358
PADI1 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-364s21c1
Sequence:CCGGAGGTGAGGGTCTCCTACTTTGCTCGAGCAAAGTAGGAGACCCTCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013358.2-2328s21c1
Sequence:CCGGAGAGGCTCTAGATCAACAATGCTCGAGCATTGTTGATCTAGAGCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-424s21c1
Sequence:CCGGACCTCACTGGCGTCGATATTTCTCGAGAAATATCGACGCCAGTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-1603s21c1
Sequence:CCGGAGAAGAAAGAAGAGGGTTATGCTCGAGCATAACCCTCTTCTTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1246s1c1
Sequence:CCGGGTCCTGACTTTGGATATGTTACTCGAGTAACATATCCAAAGTCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1767s1c1
Sequence:CCGGGAGAGTGACATCGTGGACATTCTCGAGAATGTCCACGATGTCACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-325s1c1
Sequence:CCGGGCACAGCCAGTAAGGAATTAACTCGAGTTAATTCCTTACTGGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1698s1c1
Sequence:CCGGGACAATCTTCATGCACAGAAACTCGAGTTTCTGTGCATGAAGATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-678s1c1
Sequence:CCGGCTTGTCTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013358
PADI1 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-364s21c1
Sequence:CCGGAGGTGAGGGTCTCCTACTTTGCTCGAGCAAAGTAGGAGACCCTCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013358.2-2328s21c1
Sequence:CCGGAGAGGCTCTAGATCAACAATGCTCGAGCATTGTTGATCTAGAGCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-424s21c1
Sequence:CCGGACCTCACTGGCGTCGATATTTCTCGAGAAATATCGACGCCAGTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013358.2-1603s21c1
Sequence:CCGGAGAAGAAAGAAGAGGGTTATGCTCGAGCATAACCCTCTTCTTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1246s1c1
Sequence:CCGGGTCCTGACTTTGGATATGTTACTCGAGTAACATATCCAAAGTCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1767s1c1
Sequence:CCGGGAGAGTGACATCGTGGACATTCTCGAGAATGTCCACGATGTCACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-325s1c1
Sequence:CCGGGCACAGCCAGTAAGGAATTAACTCGAGTTAATTCCTTACTGGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-1698s1c1
Sequence:CCGGGACAATCTTCATGCACAGAAACTCGAGTTTCTGTGCATGAAGATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013358.1-678s1c1
Sequence:CCGGCTTGTCTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011059
PADI1 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type I
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-1854s21c1
Sequence:CCGGCCTACGCTGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCAGCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-399s21c1
Sequence:CCGGAGGTGAAGGTGTCATACTTTGCTCGAGCAAAGTATGACACCTTCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011059.1-2590s1c1
Sequence:CCGGCGTTCAGTTCAACAGAGGCAACTCGAGTTGCCTCTGTTGAACTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-203s1c1
Sequence:CCGGCTGGTGAACGTCTATAGTGATCTCGAGATCACTATAGACGTTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-467s1c1
Sequence:CCGGGCTGTTGATGTGTCCCTTGATCTCGAGATCAAGGGACACATCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-2003s1c1
Sequence:CCGGTGCGTCTTTATCGACGACTTTCTCGAGAAAGTCGTCGATAAAGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-619s1c1
Sequence:CCGGCCTGCATGCTAACCATTTGAACTCGAGTTCAAATGGTTAGCATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011059
PADI1 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type I
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-1854s21c1
Sequence:CCGGCCTACGCTGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCAGCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-399s21c1
Sequence:CCGGAGGTGAAGGTGTCATACTTTGCTCGAGCAAAGTATGACACCTTCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011059.1-2590s1c1
Sequence:CCGGCGTTCAGTTCAACAGAGGCAACTCGAGTTGCCTCTGTTGAACTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-203s1c1
Sequence:CCGGCTGGTGAACGTCTATAGTGATCTCGAGATCACTATAGACGTTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-467s1c1
Sequence:CCGGGCTGTTGATGTGTCCCTTGATCTCGAGATCAAGGGACACATCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-2003s1c1
Sequence:CCGGTGCGTCTTTATCGACGACTTTCTCGAGAAAGTCGTCGATAAAGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-619s1c1
Sequence:CCGGCCTGCATGCTAACCATTTGAACTCGAGTTCAAATGGTTAGCATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011059
PADI1 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type I
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-1854s21c1
Sequence:CCGGCCTACGCTGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCAGCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011059.2-399s21c1
Sequence:CCGGAGGTGAAGGTGTCATACTTTGCTCGAGCAAAGTATGACACCTTCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011059.1-2590s1c1
Sequence:CCGGCGTTCAGTTCAACAGAGGCAACTCGAGTTGCCTCTGTTGAACTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-203s1c1
Sequence:CCGGCTGGTGAACGTCTATAGTGATCTCGAGATCACTATAGACGTTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-467s1c1
Sequence:CCGGGCTGTTGATGTGTCCCTTGATCTCGAGATCAAGGGACACATCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-2003s1c1
Sequence:CCGGTGCGTCTTTATCGACGACTTTCTCGAGAAAGTCGTCGATAAAGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011059.1-619s1c1
Sequence:CCGGCCTGCATGCTAACCATTTGAACTCGAGTTCAAATGGTTAGCATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)