EMAIL THIS PAGE TO A FRIEND

PADI2

peptidyl arginine deiminase, type II

107 Gene Product Result for
Synonyms: PAD-H19 PAD2 PDI2
UniProtKB ID: Q9Y2J8, Q9UPN2
Gene ID:
Human(11240) Summary: This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Mouse(18600) peptidyl arginine deiminase, type II
Rat(29511) peptidyl arginine deiminase, type II
Zebrafish(386792) peptidyl arginine deiminase, type II
cow(617851) peptidyl arginine deiminase, type II
Horse(100050025) peptidyl arginine deiminase, type II
domestic cat(101085301) peptidyl arginine deiminase, type II
chicken(428172) peptidyl arginine deiminase, type II
dog(487414) peptidyl arginine deiminase, type II
naked mole-rat(101721485) peptidyl arginine deiminase, type II
domestic guinea pig(100728531) peptidyl arginine deiminase, type II
sheep(101108464) peptidyl arginine deiminase, type II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007365 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007365 Rosetta Predictions human pricing
NM_017226 Rosetta Predictions rat pricing
NM_008812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179045 predicted 698
2 SASI_Hs01_00179046 predicted 1562
3 SASI_Hs01_00179047 predicted 662
4 SASI_Hs01_00179048 predicted 735
5 SASI_Hs01_00179049 predicted 480
6 SASI_Hs01_00179050 predicted 345
7 SASI_Hs01_00179052 predicted 696
8 SASI_Hs02_00343490 predicted 1704
9 SASI_Hs01_00179053 predicted 1379
10 SASI_Hs02_00343491 predicted 1416
11 SASI_Hs01_00179051 predicted 1029
12 SASI_Hs01_00179054 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088292 predicted 647
2 SASI_Rn01_00088293 predicted 713
3 SASI_Rn01_00088294 predicted 983
4 SASI_Rn01_00088295 predicted 898
5 SASI_Rn01_00088296 predicted 1951
6 SASI_Rn01_00088297 predicted 1005
7 SASI_Rn01_00088298 predicted 1628
8 SASI_Rn01_00088299 predicted 1104
9 SASI_Rn01_00088300 predicted 1812
10 SASI_Rn02_00261593 predicted 458
11 SASI_Rn01_00088301 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125087 predicted 687
2 SASI_Mm01_00125088 predicted 750
3 SASI_Mm01_00125090 predicted 1774
4 SASI_Mm02_00314739 predicted 1000
5 SASI_Mm02_00314740 predicted 232
6 SASI_Mm02_00314741 predicted 1143
7 SASI_Mm02_00314742 predicted 704
8 SASI_Mm01_00125093 predicted 1495
9 SASI_Mm01_00125094 predicted 636
10 SASI_Mm01_00125095 predicted 497
11 SASI_Mm01_00125089 predicted 1087
12 SASI_Mm01_00125091 predicted 978
13 SASI_Mm01_00125092 predicted 950
14 SASI_Mm01_00125096 predicted 1562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008812
VALIDATED
PADI2 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-2545s1c1
Sequence:CCGGGCACAGAATCTTCCAGAAATACTCGAGTATTTCTGGAAGATTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-622s1c1
Sequence:CCGGGTATGAAATAGTCCTCTACATCTCGAGATGTAGAGGACTATTTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1447s1c1
Sequence:CCGGCGATGAGTTTATGACTTTCATCTCGAGATGAAAGTCATAAACTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-619s1c1
Sequence:CCGGCGGGTATGAAATAGTCCTCTACTCGAGTAGAGGACTATTTCATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1742s1c1
Sequence:CCGGGCGCTCTTCAAGATGGATGAACTCGAGTTCATCCATCTTGAAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008812
VALIDATED
PADI2 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-2545s1c1
Sequence:CCGGGCACAGAATCTTCCAGAAATACTCGAGTATTTCTGGAAGATTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-622s1c1
Sequence:CCGGGTATGAAATAGTCCTCTACATCTCGAGATGTAGAGGACTATTTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1447s1c1
Sequence:CCGGCGATGAGTTTATGACTTTCATCTCGAGATGAAAGTCATAAACTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-619s1c1
Sequence:CCGGCGGGTATGAAATAGTCCTCTACTCGAGTAGAGGACTATTTCATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1742s1c1
Sequence:CCGGGCGCTCTTCAAGATGGATGAACTCGAGTTCATCCATCTTGAAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008812
VALIDATED
PADI2 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-2545s1c1
Sequence:CCGGGCACAGAATCTTCCAGAAATACTCGAGTATTTCTGGAAGATTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-622s1c1
Sequence:CCGGGTATGAAATAGTCCTCTACATCTCGAGATGTAGAGGACTATTTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1447s1c1
Sequence:CCGGCGATGAGTTTATGACTTTCATCTCGAGATGAAAGTCATAAACTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008812.1-619s1c1
Sequence:CCGGCGGGTATGAAATAGTCCTCTACTCGAGTAGAGGACTATTTCATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008812.1-1742s1c1
Sequence:CCGGGCGCTCTTCAAGATGGATGAACTCGAGTTCATCCATCTTGAAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007365
PADI2 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type II
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-1950s1c1
Sequence:CCGGGCACCTTCATCGACGACATTTCTCGAGAAATGTCGTCGATGAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-347s1c1
Sequence:CCGGGTCAACTACTATGACGAGGAACTCGAGTTCCTCGTCATAGTAGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-2032s1c1
Sequence:CCGGCACCTTCAAGTGGTTGCACATCTCGAGATGTGCAACCACTTGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-995s1c1
Sequence:CCGGGTGTGCTGCATGAAGGATAATCTCGAGATTATCCTTCATGCAGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-652s1c1
Sequence:CCGGCGGATACGAGATAGTTCTGTACTCGAGTACAGAACTATCTCGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2099s21c1
Sequence:CCGGGTTTGCCTCCTTCGCTTAGTTCTCGAGAACTAAGCGAAGGAGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2396s21c1
Sequence:CCGGTCTCTAATCTGACACTGAATGCTCGAGCATTCAGTGTCAGATTAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007365.2-945s21c1
Sequence:CCGGACACCGTGATATTCCGGATTGCTCGAGCAATCCGGAATATCACGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007365
PADI2 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type II
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-1950s1c1
Sequence:CCGGGCACCTTCATCGACGACATTTCTCGAGAAATGTCGTCGATGAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-347s1c1
Sequence:CCGGGTCAACTACTATGACGAGGAACTCGAGTTCCTCGTCATAGTAGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-2032s1c1
Sequence:CCGGCACCTTCAAGTGGTTGCACATCTCGAGATGTGCAACCACTTGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-995s1c1
Sequence:CCGGGTGTGCTGCATGAAGGATAATCTCGAGATTATCCTTCATGCAGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-652s1c1
Sequence:CCGGCGGATACGAGATAGTTCTGTACTCGAGTACAGAACTATCTCGTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2099s21c1
Sequence:CCGGGTTTGCCTCCTTCGCTTAGTTCTCGAGAACTAAGCGAAGGAGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2396s21c1
Sequence:CCGGTCTCTAATCTGACACTGAATGCTCGAGCATTCAGTGTCAGATTAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007365.2-945s21c1
Sequence:CCGGACACCGTGATATTCCGGATTGCTCGAGCAATCCGGAATATCACGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007365
PADI2 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type II
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-1950s1c1
Sequence:CCGGGCACCTTCATCGACGACATTTCTCGAGAAATGTCGTCGATGAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-347s1c1
Sequence:CCGGGTCAACTACTATGACGAGGAACTCGAGTTCCTCGTCATAGTAGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-2032s1c1
Sequence:CCGGCACCTTCAAGTGGTTGCACATCTCGAGATGTGCAACCACTTGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-995s1c1
Sequence:CCGGGTGTGCTGCATGAAGGATAATCTCGAGATTATCCTTCATGCAGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007365.1-652s1c1
Sequence:CCGGCGGATACGAGATAGTTCTGTACTCGAGTACAGAACTATCTCGTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2099s21c1
Sequence:CCGGGTTTGCCTCCTTCGCTTAGTTCTCGAGAACTAAGCGAAGGAGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007365.2-2396s21c1
Sequence:CCGGTCTCTAATCTGACACTGAATGCTCGAGCATTCAGTGTCAGATTAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007365.2-945s21c1
Sequence:CCGGACACCGTGATATTCCGGATTGCTCGAGCAATCCGGAATATCACGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)