EMAIL THIS PAGE TO A FRIEND

PADI3

peptidyl arginine deiminase, type III

57 Gene Product Result for
Synonyms: PAD3 PDI3
UniProtKB ID: Q9ULW8, Q58EY7, Q70SX5
Gene ID:
Human(51702) Summary: This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Mouse(18601) peptidyl arginine deiminase, type III
Rat(29520) peptidyl arginine deiminase, type III
sheep(443369) peptidyl arginine deiminase, type III
domestic guinea pig(100727956) peptidyl arginine deiminase, type III
naked mole-rat(101722435) peptidyl arginine deiminase, type III
Domestic Rabbit(100350962) peptidyl arginine deiminase, type III
chicken(395910) peptidyl arginine deiminase, type III
cow(508160) peptidyl arginine deiminase, type III
Horse(100049897) peptidyl arginine deiminase, type III
domestic cat(101085813) peptidyl arginine deiminase, type III
dog(478216) peptidyl arginine deiminase, type III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016233 Rosetta Predictions human pricing
NM_017230 Rosetta Predictions rat pricing
NM_011060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172541 predicted 1641
2 SASI_Hs02_00349101 predicted 1752
3 SASI_Hs01_00172543 predicted 1933
4 SASI_Hs01_00172545 predicted 237
5 SASI_Hs01_00172547 predicted 497
6 SASI_Hs01_00172548 predicted 729
7 SASI_Hs01_00172549 predicted 511
8 SASI_Hs01_00172550 predicted 1753
9 SASI_Hs02_00349102 predicted 256
10 SASI_Hs02_00349103 predicted 1786
11 SASI_Hs01_00172542 predicted 1642
12 SASI_Hs01_00172544 predicted 1653
13 SASI_Hs01_00172546 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109164 predicted 776
2 SASI_Rn01_00109165 predicted 1121
3 SASI_Rn01_00109166 predicted 1134
4 SASI_Rn01_00109167 predicted 1936
5 SASI_Rn01_00109168 predicted 524
6 SASI_Rn01_00109169 predicted 692
7 SASI_Rn01_00109170 predicted 264
8 SASI_Rn01_00109171 predicted 1381
9 SASI_Rn01_00109172 predicted 286
10 SASI_Rn01_00109173 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319818 predicted 261
2 SASI_Mm01_00181490 predicted 1935
3 SASI_Mm01_00181491 predicted 521
4 SASI_Mm01_00181495 predicted 288
5 SASI_Mm01_00181493 predicted 824
6 SASI_Mm02_00319819 predicted 700
7 SASI_Mm01_00181496 predicted 509
8 SASI_Mm01_00181497 predicted 610
9 SASI_Mm02_00319820 predicted 1208
10 SASI_Mm01_00181499 predicted 628
11 SASI_Mm01_00181492 predicted 1215
12 SASI_Mm01_00181494 predicted 266
13 SASI_Mm01_00181498 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016233
PADI3 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type III
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2320s21c1
Sequence:CCGGCACTCTGAAATCATCCATTTGCTCGAGCAAATGGATGATTTCAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2426s21c1
Sequence:CCGGTGATTCTGCTTTGGTCCAATTCTCGAGAATTGGACCAAAGCAGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1634s1c1
Sequence:CCGGGCTCTCCAATAAAGACCTCATCTCGAGATGAGGTCTTTATTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1931s1c1
Sequence:CCGGCATTGATGACTTCACTCCATACTCGAGTATGGAGTGAAGTCATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-119s1c1
Sequence:CCGGCGTGGACATTTATGGGTCAGTCTCGAGACTGACCCATAAATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1649s1c1
Sequence:CCGGCCTCATCAACTACAATAAGTTCTCGAGAACTTATTGTAGTTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-618s1c1
Sequence:CCGGCTCTTTGATGACCACAAACTTCTCGAGAAGTTTGTGGTCATCAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016233
PADI3 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type III
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2320s21c1
Sequence:CCGGCACTCTGAAATCATCCATTTGCTCGAGCAAATGGATGATTTCAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2426s21c1
Sequence:CCGGTGATTCTGCTTTGGTCCAATTCTCGAGAATTGGACCAAAGCAGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1634s1c1
Sequence:CCGGGCTCTCCAATAAAGACCTCATCTCGAGATGAGGTCTTTATTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1931s1c1
Sequence:CCGGCATTGATGACTTCACTCCATACTCGAGTATGGAGTGAAGTCATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-119s1c1
Sequence:CCGGCGTGGACATTTATGGGTCAGTCTCGAGACTGACCCATAAATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1649s1c1
Sequence:CCGGCCTCATCAACTACAATAAGTTCTCGAGAACTTATTGTAGTTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-618s1c1
Sequence:CCGGCTCTTTGATGACCACAAACTTCTCGAGAAGTTTGTGGTCATCAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016233
PADI3 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type III
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2320s21c1
Sequence:CCGGCACTCTGAAATCATCCATTTGCTCGAGCAAATGGATGATTTCAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016233.2-2426s21c1
Sequence:CCGGTGATTCTGCTTTGGTCCAATTCTCGAGAATTGGACCAAAGCAGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1634s1c1
Sequence:CCGGGCTCTCCAATAAAGACCTCATCTCGAGATGAGGTCTTTATTGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1931s1c1
Sequence:CCGGCATTGATGACTTCACTCCATACTCGAGTATGGAGTGAAGTCATCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-119s1c1
Sequence:CCGGCGTGGACATTTATGGGTCAGTCTCGAGACTGACCCATAAATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-1649s1c1
Sequence:CCGGCCTCATCAACTACAATAAGTTCTCGAGAACTTATTGTAGTTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016233.1-618s1c1
Sequence:CCGGCTCTTTGATGACCACAAACTTCTCGAGAAGTTTGTGGTCATCAAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011060
VALIDATED
PADI3 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type III
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-2773s1c1
Sequence:CCGGGCGCTGTTGATGGTTAGGAAACTCGAGTTTCCTAACCATCAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-529s1c1
Sequence:CCGGGCCCAAGATAACTGTGACCAACTCGAGTTGGTCACAGTTATCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-979s1c1
Sequence:CCGGGTGAGGAATAACACCTGCTTTCTCGAGAAAGCAGGTGTTATTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-531s1c1
Sequence:CCGGCCAAGATAACTGTGACCAATACTCGAGTATTGGTCACAGTTATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-1644s1c1
Sequence:CCGGCCAGAGCCTTATCAACTTTAACTCGAGTTAAAGTTGATAAGGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011060
VALIDATED
PADI3 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type III
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-2773s1c1
Sequence:CCGGGCGCTGTTGATGGTTAGGAAACTCGAGTTTCCTAACCATCAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-529s1c1
Sequence:CCGGGCCCAAGATAACTGTGACCAACTCGAGTTGGTCACAGTTATCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-979s1c1
Sequence:CCGGGTGAGGAATAACACCTGCTTTCTCGAGAAAGCAGGTGTTATTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-531s1c1
Sequence:CCGGCCAAGATAACTGTGACCAATACTCGAGTATTGGTCACAGTTATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-1644s1c1
Sequence:CCGGCCAGAGCCTTATCAACTTTAACTCGAGTTAAAGTTGATAAGGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011060
VALIDATED
PADI3 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type III
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-2773s1c1
Sequence:CCGGGCGCTGTTGATGGTTAGGAAACTCGAGTTTCCTAACCATCAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-529s1c1
Sequence:CCGGGCCCAAGATAACTGTGACCAACTCGAGTTGGTCACAGTTATCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-979s1c1
Sequence:CCGGGTGAGGAATAACACCTGCTTTCTCGAGAAAGCAGGTGTTATTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-531s1c1
Sequence:CCGGCCAAGATAACTGTGACCAATACTCGAGTATTGGTCACAGTTATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011060.1-1644s1c1
Sequence:CCGGCCAGAGCCTTATCAACTTTAACTCGAGTTAAAGTTGATAAGGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)