EMAIL THIS PAGE TO A FRIEND

PAEP

progestagen-associated endometrial protein

55 Gene Product Result for
Synonyms: GD GdA GdF GdS PAEG PEP PP14
UniProtKB ID: P09466, Q5T6T1, Q9UG92
Gene ID:
Human(5047) Summary: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. A number of alternatively spliced transcript variants have been observed at this locus, but the full-length nature of only two, each encoding the same protein, has been determined. [provided by RefSeq, Jul 2008]
Mouse(110645) progestagen-associated endometrial protein
cow(280838) progestagen-associated endometrial protein
Goat(100861187) progestagen-associated endometrial protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018049 Rosetta Predictions human pricing
NM_002571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017314 predicted 211
2 SASI_Hs01_00017315 predicted 241
3 SASI_Hs01_00017316 predicted 278
4 SASI_Hs01_00017318 predicted 267
5 SASI_Hs01_00017320 predicted 282
6 SASI_Hs01_00017321 predicted 332
7 SASI_Hs01_00017322 predicted 286
8 SASI_Hs02_00306938 predicted 324
9 SASI_Hs01_00017317 predicted 360
10 SASI_Hs02_00306939 predicted 252
11 SASI_Hs01_00017319 predicted 295
12 SASI_Hs01_00017323 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111984 predicted 214
2 SASI_Hs01_00111985 predicted 249
3 SASI_Hs01_00111986 predicted 279
4 SASI_Hs01_00111988 predicted 261
5 SASI_Hs01_00111990 predicted 280
6 SASI_Hs01_00111991 predicted 329
7 SASI_Hs01_00111992 predicted 287
8 SASI_Hs02_00334065 predicted 327
9 SASI_Hs01_00111987 predicted 359
10 SASI_Hs02_00334066 predicted 251
11 SASI_Hs01_00111989 predicted 289
12 SASI_Hs01_00111993 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002571
PAEP MISSION shRNA Bacterial Glycerol Stock
progestagen-associated endometrial protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c2
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c1
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-347s1c1
Sequence:CCGGGATCAACTATACGGTGGCGAACTCGAGTTCGCCACCGTATAGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-312s1c1
Sequence:CCGGCTTGGAGAGAAGACTGGGAATCTCGAGATTCCCAGTCTTCTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-329s1c1
Sequence:CCGGGAATCCAAAGAAGTTCAAGATCTCGAGATCTTGAACTTCTTTGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-541s21c1
Sequence:CCGGGGTACTTGCTGGACTTGAAACCTCGAGGTTTCAAGTCCAGCAAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-295s21c1
Sequence:CCGGGTGTTGAGAAGAAGGTCCTTGCTCGAGCAAGGACCTTCTTCTCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-488s21c1
Sequence:CCGGTGAGATCATGCAGGGATTCATCTCGAGATGAATCCCTGCATGATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-252s21c1
Sequence:CCGGGACAACCTGGAGATCGTTCTGCTCGAGCAGAACGATCTCCAGGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002571
PAEP MISSION shRNA shRNA Plasmid DNA
progestagen-associated endometrial protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c2
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c1
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-347s1c1
Sequence:CCGGGATCAACTATACGGTGGCGAACTCGAGTTCGCCACCGTATAGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-312s1c1
Sequence:CCGGCTTGGAGAGAAGACTGGGAATCTCGAGATTCCCAGTCTTCTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-329s1c1
Sequence:CCGGGAATCCAAAGAAGTTCAAGATCTCGAGATCTTGAACTTCTTTGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-541s21c1
Sequence:CCGGGGTACTTGCTGGACTTGAAACCTCGAGGTTTCAAGTCCAGCAAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-295s21c1
Sequence:CCGGGTGTTGAGAAGAAGGTCCTTGCTCGAGCAAGGACCTTCTTCTCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-488s21c1
Sequence:CCGGTGAGATCATGCAGGGATTCATCTCGAGATGAATCCCTGCATGATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-252s21c1
Sequence:CCGGGACAACCTGGAGATCGTTCTGCTCGAGCAGAACGATCTCCAGGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002571
PAEP MISSION shRNA Lentiviral Transduction Particles
progestagen-associated endometrial protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c2
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-383s1c1
Sequence:CCGGCGATACTGACTACGACAATTTCTCGAGAAATTGTCGTAGTCAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-347s1c1
Sequence:CCGGGATCAACTATACGGTGGCGAACTCGAGTTCGCCACCGTATAGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-312s1c1
Sequence:CCGGCTTGGAGAGAAGACTGGGAATCTCGAGATTCCCAGTCTTCTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002571.1-329s1c1
Sequence:CCGGGAATCCAAAGAAGTTCAAGATCTCGAGATCTTGAACTTCTTTGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-541s21c1
Sequence:CCGGGGTACTTGCTGGACTTGAAACCTCGAGGTTTCAAGTCCAGCAAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-295s21c1
Sequence:CCGGGTGTTGAGAAGAAGGTCCTTGCTCGAGCAAGGACCTTCTTCTCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-488s21c1
Sequence:CCGGTGAGATCATGCAGGGATTCATCTCGAGATGAATCCCTGCATGATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002571.2-252s21c1
Sequence:CCGGGACAACCTGGAGATCGTTCTGCTCGAGCAGAACGATCTCCAGGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)