EMAIL THIS PAGE TO A FRIEND

PAF1

Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)

54 Gene Product Result for
Synonyms: F23149_1 PD2
UniProtKB ID: Q8N7H5, O75239, Q9H166, Q9NUU9
Gene ID:
Human(54623) Summary: This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(54624) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Rat(361531) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Thale Cress(834290) proteasome alpha subunit F1
chicken(100858108) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Zebrafish(553020) paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
cow(528744) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Horse(100064458) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
domestic cat(101097363) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
dog(476464) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
sheep(101115394) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
naked mole-rat(101698302) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
domestic guinea pig(100713356) Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019088 Rosetta Predictions human pricing
NM_001024898 Rosetta Predictions rat pricing
NM_019458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045419 predicted 1718
2 SASI_Hs01_00045420 predicted 1793
3 SASI_Hs01_00045421 predicted 1016
4 SASI_Hs01_00045422 predicted 1837
5 SASI_Hs01_00045423 predicted 696
6 SASI_Hs01_00045424 predicted 881
7 SASI_Hs01_00045425 predicted 272
8 SASI_Hs01_00045427 predicted 1728
9 SASI_Hs01_00045428 predicted 1078
10 SASI_Hs02_00352687 predicted 786
11 SASI_Hs01_00045426 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117468 predicted 1078
2 SASI_Rn01_00117469 predicted 597
3 SASI_Rn01_00117470 predicted 1567
4 SASI_Rn01_00117471 predicted 1106
5 SASI_Rn02_00202798 predicted 727
6 SASI_Rn01_00117473 predicted 477
7 SASI_Rn01_00117474 predicted 1230
8 SASI_Rn01_00117475 predicted 816
9 SASI_Rn01_00117476 predicted 913
10 SASI_Rn01_00117477 predicted 1248
11 SASI_Rn01_00117472 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192022 predicted 515
2 SASI_Mm01_00192023 predicted 1120
3 SASI_Mm01_00192024 predicted 1084
4 SASI_Mm02_00324452 predicted 1111
5 SASI_Mm01_00192025 predicted 1574
6 SASI_Mm01_00192026 predicted 1482
7 SASI_Mm01_00192027 predicted 1233
8 SASI_Mm01_00192028 predicted 726
9 SASI_Mm01_00192029 predicted 925
10 SASI_Mm01_00192031 predicted 1015
11 SASI_Mm01_00192030 predicted 1447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019088
PAF1 MISSION shRNA Bacterial Glycerol Stock
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-267s21c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-1605s21c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-565s21c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019088.2-1789s21c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019088.2-1789s1c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-267s1c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1605s1c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1069s1c1
Sequence:CCGGCGTGAAGAACAAAGCTAGCAACTCGAGTTGCTAGCTTTGTTCTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-565s1c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019088
PAF1 MISSION shRNA shRNA Plasmid DNA
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-267s21c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-1605s21c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-565s21c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019088.2-1789s21c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019088.2-1789s1c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-267s1c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1605s1c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1069s1c1
Sequence:CCGGCGTGAAGAACAAAGCTAGCAACTCGAGTTGCTAGCTTTGTTCTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-565s1c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019088
PAF1 MISSION shRNA Lentiviral Transduction Particles
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-267s21c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-1605s21c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019088.2-565s21c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019088.2-1789s21c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019088.2-1789s1c1
Sequence:CCGGGCTGGTTCAGACACCATTATTCTCGAGAATAATGGTGTCTGAACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-267s1c1
Sequence:CCGGGCCGAGTCAAGTACTGCAATACTCGAGTATTGCAGTACTTGACTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1605s1c1
Sequence:CCGGGCAGTGACAATGATTCAGACACTCGAGTGTCTGAATCATTGTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-1069s1c1
Sequence:CCGGCGTGAAGAACAAAGCTAGCAACTCGAGTTGCTAGCTTTGTTCTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019088.2-565s1c1
Sequence:CCGGGATGCGAAAGACAGAGTACATCTCGAGATGTACTCTGTCTTTCGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019458
VALIDATED
PAF1 MISSION shRNA Bacterial Glycerol Stock
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1194s21c1
Sequence:CCGGACCAGGGTCCGTCTAAGTAAGCTCGAGCTTACTTAGACGGACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-1127s21c1
Sequence:CCGGGGGCTATGAGGAGAACTATTTCTCGAGAAATAGTTCTCCTCATAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1076s21c1
Sequence:CCGGCTATAAGATTGCTCGGGAATACTCGAGTATTCCCGAGCAATCTTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-974s21c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1157s21c1
Sequence:CCGGCAGAGAGGGTGACGGAGTTTACTCGAGTAAACTCCGTCACCCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019458.2-1272s1c1
Sequence:CCGGCGTGACATGAATGAGAAGGAACTCGAGTTCCTTCTCATTCATGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1262s1c1
Sequence:CCGGCGTCAAACACCGTGACATGAACTCGAGTTCATGTCACGGTGTTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1044s1c1
Sequence:CCGGGAGATGGACTATGCACCAGATCTCGAGATCTGGTGCATAGTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-974s1c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-602s1c1
Sequence:CCGGGATGCGTAAGACAGAGTATATCTCGAGATATACTCTGTCTTACGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019458
VALIDATED
PAF1 MISSION shRNA shRNA Plasmid DNA
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1194s21c1
Sequence:CCGGACCAGGGTCCGTCTAAGTAAGCTCGAGCTTACTTAGACGGACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-1127s21c1
Sequence:CCGGGGGCTATGAGGAGAACTATTTCTCGAGAAATAGTTCTCCTCATAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1076s21c1
Sequence:CCGGCTATAAGATTGCTCGGGAATACTCGAGTATTCCCGAGCAATCTTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-974s21c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1157s21c1
Sequence:CCGGCAGAGAGGGTGACGGAGTTTACTCGAGTAAACTCCGTCACCCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019458.2-1272s1c1
Sequence:CCGGCGTGACATGAATGAGAAGGAACTCGAGTTCCTTCTCATTCATGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1262s1c1
Sequence:CCGGCGTCAAACACCGTGACATGAACTCGAGTTCATGTCACGGTGTTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1044s1c1
Sequence:CCGGGAGATGGACTATGCACCAGATCTCGAGATCTGGTGCATAGTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-974s1c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-602s1c1
Sequence:CCGGGATGCGTAAGACAGAGTATATCTCGAGATATACTCTGTCTTACGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019458
VALIDATED
PAF1 MISSION shRNA Lentiviral Transduction Particles
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1194s21c1
Sequence:CCGGACCAGGGTCCGTCTAAGTAAGCTCGAGCTTACTTAGACGGACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-1127s21c1
Sequence:CCGGGGGCTATGAGGAGAACTATTTCTCGAGAAATAGTTCTCCTCATAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1076s21c1
Sequence:CCGGCTATAAGATTGCTCGGGAATACTCGAGTATTCCCGAGCAATCTTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019458.3-974s21c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019458.3-1157s21c1
Sequence:CCGGCAGAGAGGGTGACGGAGTTTACTCGAGTAAACTCCGTCACCCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019458.2-1272s1c1
Sequence:CCGGCGTGACATGAATGAGAAGGAACTCGAGTTCCTTCTCATTCATGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1262s1c1
Sequence:CCGGCGTCAAACACCGTGACATGAACTCGAGTTCATGTCACGGTGTTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-1044s1c1
Sequence:CCGGGAGATGGACTATGCACCAGATCTCGAGATCTGGTGCATAGTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-974s1c1
Sequence:CCGGGAACCAGTTTGTGGCTTATTTCTCGAGAAATAAGCCACAAACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019458.2-602s1c1
Sequence:CCGGGATGCGTAAGACAGAGTATATCTCGAGATATACTCTGTCTTACGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)