EMAIL THIS PAGE TO A FRIEND

PAFAH1B1

platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)

272 Gene Product Result for
Synonyms: LIS1 LIS2 MDCR MDS PAFAH
UniProtKB ID: P43034, B2R7Q7, Q8WZ88, Q8WZ89
Gene ID:
Human(5048) Summary: This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
Mouse(18472) platelet-activating factor acetylhydrolase, isoform 1b, subunit 1
Rat(83572) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1
chicken(374224) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
cow(282513) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Horse(100072490) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
domestic cat(100135766) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
dog(480656) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
domestic guinea pig(100734716) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
naked mole-rat(101709906) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
sheep(101119146) platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500302 Anti-LIS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
L7391 Anti-LIS1 antibody, Mouse monoclonal clone LIS1-338, purified from hybridoma cell culture bovine, chicken, human, zebrafish, rat, mouse
immunoprecipitation (IP), microarray, western blot pricing
SAB2500597 Anti-LIS1/PAFAH1B1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, western blot pricing
HPA020036 Anti-PAFAH1B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104109 Anti-PAFAH1B1, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, human, mouse, horse, dog, rat, rabbit
immunohistochemistry, western blot pricing
SAB2104110 Anti-PAFAH1B1, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human, mouse, bovine, rat, dog
immunohistochemistry, western blot pricing
WH0005048M1 Monoclonal Anti-PAFAH1B1 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404161 Monoclonal Anti-PAFAH1B1, (N-terminal) antibody produced in mouse clone 5A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000430 Rosetta Predictions human pricing
NM_031763 Rosetta Predictions rat pricing
NM_013625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019092 predicted 1508
2 SASI_Hs01_00019093 predicted 1337
3 SASI_Hs01_00019094 predicted 1860
4 SASI_Hs01_00019095 predicted 1000
5 SASI_Hs01_00019096 predicted 1519
6 SASI_Hs01_00019097 predicted 1268
7 SASI_Hs01_00019098 predicted 1470
8 SASI_Hs01_00019099 predicted 1279
9 SASI_Hs02_00302539 predicted 1876
10 SASI_Hs01_00019100 predicted 1181
11 SASI_Hs01_00019101 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031319 predicted 1723
2 SASI_Rn01_00031320 predicted 1265
3 SASI_Rn01_00031321 predicted 1203
4 SASI_Rn01_00031322 predicted 885
5 SASI_Rn01_00031323 predicted 1109
6 SASI_Rn01_00031324 predicted 998
7 SASI_Rn01_00031325 predicted 941
8 SASI_Rn02_00265182 predicted 1373
9 SASI_Rn01_00031326 predicted 1425
10 SASI_Rn01_00031327 predicted 1014
11 SASI_Rn01_00031328 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133015 predicted 1253
2 SASI_Mm01_00133016 predicted 1841
3 SASI_Mm01_00133017 predicted 1359
4 SASI_Mm01_00133018 predicted 1244
5 SASI_Mm01_00133019 predicted 1474
6 SASI_Mm01_00133020 predicted 1560
7 SASI_Mm01_00133021 predicted 1945
8 SASI_Mm01_00133022 predicted 1244
9 SASI_Mm01_00133023 predicted 1945
10 SASI_Mm01_00133024 predicted 1376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000430
VALIDATED
PAFAH1B1 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1083s21c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1698s1c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-614s21c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-601s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1644s1c1
Sequence:CCGGCGTATGGGATTACAAGAACAACTCGAGTTGTTCTTGTAATCCCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1070s1c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-658s1c1
Sequence:CCGGGCTGAATTAGATGTGAATGAACTCGAGTTCATTCACATCTAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000430.3-1168s21c1
Sequence:CCGGCATGCCCAATGGAGATCATATCTCGAGATATGATCTCCATTGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000430.3-1918s21c1
Sequence:CCGGGATGTAGATTGAGCTTATTAACTCGAGTTAATAAGCTCAATCTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1711s21c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000430
VALIDATED
PAFAH1B1 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1083s21c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1698s1c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-614s21c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-601s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1644s1c1
Sequence:CCGGCGTATGGGATTACAAGAACAACTCGAGTTGTTCTTGTAATCCCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1070s1c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-658s1c1
Sequence:CCGGGCTGAATTAGATGTGAATGAACTCGAGTTCATTCACATCTAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000430.3-1168s21c1
Sequence:CCGGCATGCCCAATGGAGATCATATCTCGAGATATGATCTCCATTGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000430.3-1918s21c1
Sequence:CCGGGATGTAGATTGAGCTTATTAACTCGAGTTAATAAGCTCAATCTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1711s21c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000430
VALIDATED
PAFAH1B1 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1083s21c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1698s1c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-614s21c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-601s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1644s1c1
Sequence:CCGGCGTATGGGATTACAAGAACAACTCGAGTTGTTCTTGTAATCCCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-1070s1c1
Sequence:CCGGTGACCATTAAACTATGGGATTCTCGAGAATCCCATAGTTTAATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000430.2-658s1c1
Sequence:CCGGGCTGAATTAGATGTGAATGAACTCGAGTTCATTCACATCTAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000430.3-1168s21c1
Sequence:CCGGCATGCCCAATGGAGATCATATCTCGAGATATGATCTCCATTGGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000430.3-1918s21c1
Sequence:CCGGGATGTAGATTGAGCTTATTAACTCGAGTTAATAAGCTCAATCTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000430.3-1711s21c1
Sequence:CCGGCTTTGTTACCTCCTTGGATTTCTCGAGAAATCCAAGGAGGTAACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013625
VALIDATED
PAFAH1B1 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.1-2052s1c1
Sequence:CCGGGCAGTGTAGATCAAACAGTAACTCGAGTTACTGTTTGATCTACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1459s1c1
Sequence:CCGGCATGCCTAATGGAGATCATATCTCGAGATATGATCTCCATTAGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1855s1c1
Sequence:CCGGGACTCTTGTGGGTCATGATAACTCGAGTTATCATGACCCACAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1433s1c1
Sequence:CCGGGATCACAATGTCTCTTCAGTACTCGAGTACTGAAGAGACATTGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1734s1c1
Sequence:CCGGCCATCTCTGAAGCAACAGGATCTCGAGATCCTGTTGCTTCAGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-905s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-5454s1c1
Sequence:CCGGGCTGCTTTCTTGCCTGCTTATCTCGAGATAAGCAGGCAAGAAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1023s1c1
Sequence:CCGGGGACATCTGTTATTAGATTACCTCGAGGTAATCTAATAACAGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-2461s1c1
Sequence:CCGGCCTGACTTGATGGCCTCATTTCTCGAGAAATGAGGCCATCAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013625
VALIDATED
PAFAH1B1 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.1-2052s1c1
Sequence:CCGGGCAGTGTAGATCAAACAGTAACTCGAGTTACTGTTTGATCTACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1459s1c1
Sequence:CCGGCATGCCTAATGGAGATCATATCTCGAGATATGATCTCCATTAGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1855s1c1
Sequence:CCGGGACTCTTGTGGGTCATGATAACTCGAGTTATCATGACCCACAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1433s1c1
Sequence:CCGGGATCACAATGTCTCTTCAGTACTCGAGTACTGAAGAGACATTGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1734s1c1
Sequence:CCGGCCATCTCTGAAGCAACAGGATCTCGAGATCCTGTTGCTTCAGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-905s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-5454s1c1
Sequence:CCGGGCTGCTTTCTTGCCTGCTTATCTCGAGATAAGCAGGCAAGAAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1023s1c1
Sequence:CCGGGGACATCTGTTATTAGATTACCTCGAGGTAATCTAATAACAGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-2461s1c1
Sequence:CCGGCCTGACTTGATGGCCTCATTTCTCGAGAAATGAGGCCATCAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013625
VALIDATED
PAFAH1B1 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.1-2052s1c1
Sequence:CCGGGCAGTGTAGATCAAACAGTAACTCGAGTTACTGTTTGATCTACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1459s1c1
Sequence:CCGGCATGCCTAATGGAGATCATATCTCGAGATATGATCTCCATTAGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1855s1c1
Sequence:CCGGGACTCTTGTGGGTCATGATAACTCGAGTTATCATGACCCACAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1433s1c1
Sequence:CCGGGATCACAATGTCTCTTCAGTACTCGAGTACTGAAGAGACATTGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-1734s1c1
Sequence:CCGGCCATCTCTGAAGCAACAGGATCTCGAGATCCTGTTGCTTCAGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013625.1-905s1c1
Sequence:CCGGGCAGATTATCTTCGTTCAAATCTCGAGATTTGAACGAAGATAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-5454s1c1
Sequence:CCGGGCTGCTTTCTTGCCTGCTTATCTCGAGATAAGCAGGCAAGAAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013625.2-1023s1c1
Sequence:CCGGGGACATCTGTTATTAGATTACCTCGAGGTAATCTAATAACAGATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013625.1-2461s1c1
Sequence:CCGGCCTGACTTGATGGCCTCATTTCTCGAGAAATGAGGCCATCAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)