EMAIL THIS PAGE TO A FRIEND

PAFAH1B2

platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)

228 Gene Product Result for
Gene ID:
Human(5049) Summary: Platelet-activating factor acetylhydrolase (PAFAH) inactivates platelet-activating factor (PAF) into acetate and LYSO-PAF. This gene encodes the beta subunit of PAFAH, the other subunits are alpha and gamma. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [providedby RefSeq, May 2010]
Mouse(18475) platelet-activating factor acetylhydrolase, isoform 1b, subunit 2
Rat(64189) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2
Zebrafish(567170) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2
chicken(419765) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
dog(479425) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
domestic cat(101085656) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
cow(282514) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
sheep(101118047) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
naked mole-rat(101697537) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
domestic guinea pig(100731662) platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002572 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147151 MISSION® esiRNA esiRNA human PAFAH1B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002572 Rosetta Predictions human pricing
NM_022387 Rosetta Predictions rat pricing
NM_008775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041107 predicted 788
2 SASI_Hs01_00041108 predicted 755
3 SASI_Hs01_00041109 predicted 497
4 SASI_Hs01_00041110 predicted 294
5 SASI_Hs01_00041111 predicted 250
6 SASI_Hs01_00041112 predicted 745
7 SASI_Hs01_00041114 predicted 874
8 SASI_Hs02_00334067 predicted 390
9 SASI_Hs01_00041116 predicted 325
10 SASI_Hs02_00334068 predicted 510
11 SASI_Hs01_00041113 predicted 836
12 SASI_Hs01_00041115 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075845 predicted 619
2 SASI_Rn01_00075846 predicted 480
3 SASI_Rn01_00075847 predicted 471
4 SASI_Rn01_00075848 predicted 249
5 SASI_Rn01_00075850 predicted 998
6 SASI_Rn01_00075851 predicted 892
7 SASI_Rn01_00075852 predicted 412
8 SASI_Rn01_00075853 predicted 519
9 SASI_Rn02_00263154 predicted 937
10 SASI_Rn01_00075854 predicted 532
11 SASI_Rn01_00075849 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149500 predicted 522
2 SASI_Mm01_00149501 predicted 674
3 SASI_Mm01_00149502 predicted 1088
4 SASI_Mm01_00149503 predicted 366
5 SASI_Mm01_00149504 predicted 1037
6 SASI_Mm01_00149505 predicted 933
7 SASI_Mm01_00149506 predicted 523
8 SASI_Mm01_00149507 predicted 987
9 SASI_Mm01_00149508 predicted 581
10 SASI_Mm01_00149509 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008775
VALIDATED
PAFAH1B2 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-478s21c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-366s21c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-529s21c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008775.3-1443s1c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-366s1c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-262s1c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008775.3-529s1c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-478s1c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-262s21c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008775.3-1443s21c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008775
VALIDATED
PAFAH1B2 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-478s21c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-366s21c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-529s21c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008775.3-1443s1c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-366s1c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-262s1c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008775.3-529s1c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-478s1c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-262s21c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008775.3-1443s21c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008775
VALIDATED
PAFAH1B2 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-478s21c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-366s21c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-529s21c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008775.3-1443s1c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-366s1c1
Sequence:CCGGCCCACTTCATGCTCTTAATTTCTCGAGAAATTAAGAGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-262s1c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008775.3-529s1c1
Sequence:CCGGGAGGCTATTGTACAACTTATACTCGAGTATAAGTTGTACAATAGCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008775.3-478s1c1
Sequence:CCGGGTAGGGACAAACAACCACGAACTCGAGTTCGTGGTTGTTTGTCCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008775.3-262s21c1
Sequence:CCGGAGGTTTGTTCTGGACTGTAAACTCGAGTTTACAGTCCAGAACAAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008775.3-1443s21c1
Sequence:CCGGGCTGATTATCATGTCTGTAATCTCGAGATTACAGACATGATAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002572
VALIDATED
PAFAH1B2 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-894s21c1
Sequence:GTACCGGATGTTCCTGGATGTTCATATCCTCGAGGATATGAACATCCAGGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-399s21c1
Sequence:GTACCGGTGTCTGGGTAGGAACAAATAACTCGAGTTATTTGTTCCTACCCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-783s21c1
Sequence:CCGGCATTGCCTGACTGGCTCTTATCTCGAGATAAGAGCCAGTCAGGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002572.2-250s21c1
Sequence:CCGGGTGCAGTTAATGCAGCAATATCTCGAGATATTGCTGCATTAACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-377s21c1
Sequence:CCGGATATTAAGCCTAAGGTCATTGCTCGAGCAATGACCTTAGGCTTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-248s1c1
Sequence:CCGGTGGTGCAGTTAATGCAGCAATCTCGAGATTGCTGCATTAACTGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-294s1c1
Sequence:CCGGCCCACTTCATGCACTGAATTTCTCGAGAAATTCAGTGCATGAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-527s1c1
Sequence:CCGGGAGGTGAGAAACCCAATCCTTCTCGAGAAGGATTGGGTTTCTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-406s1c1
Sequence:CCGGGTAGGAACAAATAACCACGAACTCGAGTTCGTGGTTATTTGTTCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-729s1c1
Sequence:CCGGGCATGAACTGATCATGCAGTTCTCGAGAACTGCATGATCAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002572
VALIDATED
PAFAH1B2 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-894s21c1
Sequence:GTACCGGATGTTCCTGGATGTTCATATCCTCGAGGATATGAACATCCAGGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-399s21c1
Sequence:GTACCGGTGTCTGGGTAGGAACAAATAACTCGAGTTATTTGTTCCTACCCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-783s21c1
Sequence:CCGGCATTGCCTGACTGGCTCTTATCTCGAGATAAGAGCCAGTCAGGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002572.2-250s21c1
Sequence:CCGGGTGCAGTTAATGCAGCAATATCTCGAGATATTGCTGCATTAACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-377s21c1
Sequence:CCGGATATTAAGCCTAAGGTCATTGCTCGAGCAATGACCTTAGGCTTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-248s1c1
Sequence:CCGGTGGTGCAGTTAATGCAGCAATCTCGAGATTGCTGCATTAACTGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-294s1c1
Sequence:CCGGCCCACTTCATGCACTGAATTTCTCGAGAAATTCAGTGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-527s1c1
Sequence:CCGGGAGGTGAGAAACCCAATCCTTCTCGAGAAGGATTGGGTTTCTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-406s1c1
Sequence:CCGGGTAGGAACAAATAACCACGAACTCGAGTTCGTGGTTATTTGTTCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-729s1c1
Sequence:CCGGGCATGAACTGATCATGCAGTTCTCGAGAACTGCATGATCAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002572
VALIDATED
PAFAH1B2 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-894s21c1
Sequence:GTACCGGATGTTCCTGGATGTTCATATCCTCGAGGATATGAACATCCAGGAACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-399s21c1
Sequence:GTACCGGTGTCTGGGTAGGAACAAATAACTCGAGTTATTTGTTCCTACCCAGACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-783s21c1
Sequence:CCGGCATTGCCTGACTGGCTCTTATCTCGAGATAAGAGCCAGTCAGGCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002572.2-250s21c1
Sequence:CCGGGTGCAGTTAATGCAGCAATATCTCGAGATATTGCTGCATTAACTGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002572.2-377s21c1
Sequence:CCGGATATTAAGCCTAAGGTCATTGCTCGAGCAATGACCTTAGGCTTAATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-248s1c1
Sequence:CCGGTGGTGCAGTTAATGCAGCAATCTCGAGATTGCTGCATTAACTGCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-294s1c1
Sequence:CCGGCCCACTTCATGCACTGAATTTCTCGAGAAATTCAGTGCATGAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-527s1c1
Sequence:CCGGGAGGTGAGAAACCCAATCCTTCTCGAGAAGGATTGGGTTTCTCACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-406s1c1
Sequence:CCGGGTAGGAACAAATAACCACGAACTCGAGTTCGTGGTTATTTGTTCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002572.1-729s1c1
Sequence:CCGGGCATGAACTGATCATGCAGTTCTCGAGAACTGCATGATCAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)