EMAIL THIS PAGE TO A FRIEND

PAFAH2

platelet-activating factor acetylhydrolase 2, 40kDa

91 Gene Product Result for
Synonyms: HSD-PLA2
UniProtKB ID: Q99487, D3DPK1, O15458, Q5SY02
Gene ID:
Human(5051) Summary: This gene encodes platelet-activating factor acetylhydrolase isoform 2, a single-subunit intracellular enzyme that catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). However, this lipase exhibits a broader substrate specificity than simply platelet activating factor. Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist, and both are multi-subunit enzymes. Additionally, there is a single-subunit serum isoform of this enzyme. [provided by RefSeq, Jul 2008]
Mouse(100163) platelet-activating factor acetylhydrolase 2
Rat(313611) platelet-activating factor acetylhydrolase 2
chicken(769963) platelet-activating factor acetylhydrolase 2, 40kDa
dog(478174) platelet-activating factor acetylhydrolase 2, 40kDa
cow(282299) platelet-activating factor acetylhydrolase 2, 40kDa
Horse(100057370) platelet-activating factor acetylhydrolase 2, 40kDa
domestic cat(101083190) platelet-activating factor acetylhydrolase 2, 40kDa
sheep(101113661) platelet-activating factor acetylhydrolase 2, 40kDa
naked mole-rat(101703371) platelet-activating factor acetylhydrolase 2, 40kDa
Domestic Rabbit(100338757) platelet-activating factor acetylhydrolase 2, 40kDa
domestic guinea pig(100732486) platelet-activating factor acetylhydrolase 2, 40kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000437 Rosetta Predictions human pricing
NM_177932 Rosetta Predictions rat pricing
NM_133880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162210 predicted 1123
2 SASI_Hs01_00162211 predicted 1152
3 SASI_Hs02_00302547 predicted 422
4 SASI_Hs01_00162214 predicted 1214
5 SASI_Hs01_00162215 predicted 827
6 SASI_Hs01_00162216 predicted 1355
7 SASI_Hs01_00162217 predicted 1078
8 SASI_Hs01_00162218 predicted 1036
9 SASI_Hs02_00302548 predicted 1094
10 SASI_Hs01_00162219 predicted 896
11 SASI_Hs01_00162212 predicted 1064
12 SASI_Hs01_00162213 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116163 predicted 749
2 SASI_Rn01_00116164 predicted 299
3 SASI_Rn01_00116165 predicted 829
4 SASI_Rn01_00116166 predicted 531
5 SASI_Rn01_00116167 predicted 757
6 SASI_Rn01_00116168 predicted 314
7 SASI_Rn01_00116170 predicted 935
8 SASI_Rn01_00116171 predicted 530
9 SASI_Rn01_00116172 predicted 615
10 SASI_Rn02_00269596 predicted 945
11 SASI_Rn01_00116169 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180435 predicted 1141
2 SASI_Mm01_00180436 predicted 547
3 SASI_Mm01_00180437 predicted 1721
4 SASI_Mm01_00180438 predicted 909
5 SASI_Mm01_00180439 predicted 472
6 SASI_Mm01_00180440 predicted 1003
7 SASI_Mm01_00180441 predicted 986
8 SASI_Mm01_00180442 predicted 998
9 SASI_Mm01_00180443 predicted 509
10 SASI_Mm01_00180444 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133880
VALIDATED
PAFAH2 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 2, 40kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-411s21c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1036s21c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133880.2-1426s21c1
Sequence:CCGGGGCTGATTGGGAAGCGGATTTCTCGAGAAATCCGCTTCCCAATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-938s21c1
Sequence:CCGGCTTTATCAACGTCGAGAAATTCTCGAGAATTTCTCGACGTTGATAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1205s21c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133880.1-2915s1c1
Sequence:CCGGCGCTGCATAAATCGCATAAATCTCGAGATTTATGCGATTTATGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1322s1c1
Sequence:CCGGCCGCACTATCTGTCTAGTCTACTCGAGTAGACTAGACAGATAGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-473s1c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1267s1c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133880.1-1098s1c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133880
VALIDATED
PAFAH2 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 2, 40kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-411s21c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1036s21c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133880.2-1426s21c1
Sequence:CCGGGGCTGATTGGGAAGCGGATTTCTCGAGAAATCCGCTTCCCAATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-938s21c1
Sequence:CCGGCTTTATCAACGTCGAGAAATTCTCGAGAATTTCTCGACGTTGATAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1205s21c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133880.1-2915s1c1
Sequence:CCGGCGCTGCATAAATCGCATAAATCTCGAGATTTATGCGATTTATGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1322s1c1
Sequence:CCGGCCGCACTATCTGTCTAGTCTACTCGAGTAGACTAGACAGATAGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-473s1c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1267s1c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133880.1-1098s1c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133880
VALIDATED
PAFAH2 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 2, 40kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-411s21c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1036s21c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133880.2-1426s21c1
Sequence:CCGGGGCTGATTGGGAAGCGGATTTCTCGAGAAATCCGCTTCCCAATCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-938s21c1
Sequence:CCGGCTTTATCAACGTCGAGAAATTCTCGAGAATTTCTCGACGTTGATAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133880.2-1205s21c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110990    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133880.1-2915s1c1
Sequence:CCGGCGCTGCATAAATCGCATAAATCTCGAGATTTATGCGATTTATGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1322s1c1
Sequence:CCGGCCGCACTATCTGTCTAGTCTACTCGAGTAGACTAGACAGATAGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-473s1c1
Sequence:CCGGCCTTTGATCATCTTGTCCCATCTCGAGATGGGACAAGATGATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133880.1-1267s1c1
Sequence:CCGGCGATCAATGGAGCAGCTTCATCTCGAGATGAAGCTGCTCCATTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133880.1-1098s1c1
Sequence:CCGGGCGCTGTTCATCGGAGTCAAACTCGAGTTTGACTCCGATGAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000437
VALIDATED
PAFAH2 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 2, 40kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000437.3-1495s21c1
Sequence:CCGGCTTGGATAACTGGGTACTTTGCTCGAGCAAAGTACCCAGTTATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-1263s21c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-244s21c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000437.3-598s21c1
Sequence:CCGGTCAGCGGCAACCACCTATTTCCTCGAGGAAATAGGTGGTTGCCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-750s21c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1103s1c1
Sequence:CCGGGCATGAACAGTCTAGGATCATCTCGAGATGATCCTAGACTGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1286s1c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000437.2-390s1c1
Sequence:CCGGGCCGAGTACCTGCAGTTTAATCTCGAGATTAAACTGCAGGTACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-267s1c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-773s1c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000437
VALIDATED
PAFAH2 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 2, 40kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000437.3-1495s21c1
Sequence:CCGGCTTGGATAACTGGGTACTTTGCTCGAGCAAAGTACCCAGTTATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-1263s21c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-244s21c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000437.3-598s21c1
Sequence:CCGGTCAGCGGCAACCACCTATTTCCTCGAGGAAATAGGTGGTTGCCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-750s21c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1103s1c1
Sequence:CCGGGCATGAACAGTCTAGGATCATCTCGAGATGATCCTAGACTGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1286s1c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000437.2-390s1c1
Sequence:CCGGGCCGAGTACCTGCAGTTTAATCTCGAGATTAAACTGCAGGTACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-267s1c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-773s1c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000437
VALIDATED
PAFAH2 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 2, 40kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000437.3-1495s21c1
Sequence:CCGGCTTGGATAACTGGGTACTTTGCTCGAGCAAAGTACCCAGTTATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-1263s21c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-244s21c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000437.3-598s21c1
Sequence:CCGGTCAGCGGCAACCACCTATTTCCTCGAGGAAATAGGTGGTTGCCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000437.3-750s21c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1103s1c1
Sequence:CCGGGCATGAACAGTCTAGGATCATCTCGAGATGATCCTAGACTGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-1286s1c1
Sequence:CCGGCGACCTGAAAGAAGACTATAACTCGAGTTATAGTCTTCTTTCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000437.2-390s1c1
Sequence:CCGGGCCGAGTACCTGCAGTTTAATCTCGAGATTAAACTGCAGGTACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-267s1c1
Sequence:CCGGGATGTGATGGAGGGTCAGAATCTCGAGATTCTGACCCTCCATCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000437.2-773s1c1
Sequence:CCGGCGAGTGTTTACGGGTGTTGAACTCGAGTTCAACACCCGTAAACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)