EMAIL THIS PAGE TO A FRIEND

PAG1

phosphoprotein associated with glycosphingolipid microdomains 1

226 Gene Product Result for
Synonyms: CBP PAG
UniProtKB ID: Q9NWQ8, A8K1A3, Q2M1Z9, Q5BKU4, Q9NYK0
Gene ID:
Human(55824) Summary: The protein encoded by this gene is a type III transmembrane adaptor protein that binds to the tyrosine kinase csk protein. It is thought to be involved in the regulation of T cell activation. [provided by RefSeq, Jul 2008]
Mouse(94212) phosphoprotein associated with glycosphingolipid microdomains 1
Rat(64019) phosphoprotein associated with glycosphingolipid microdomains 1
sheep(101112826) phosphoprotein associated with glycosphingolipid microdomains 1
domestic guinea pig(100733379) phosphoprotein associated with glycosphingolipid microdomains 1
naked mole-rat(101708734) phosphoprotein associated with glycosphingolipid microdomains 1
Thale Cress(817244) 20S proteasome alpha subunit G1
Zebrafish(100034498) ZDB-PUB-030905-1
dog(610895) phosphoprotein associated with glycosphingolipid microdomains 1
cow(614460) phosphoprotein associated with glycosphingolipid microdomains 1
cow(281964) pregnancy-associated glycoprotein 1
Horse(100050548) phosphoprotein associated with glycosphingolipid microdomains 1
domestic cat(101086450) phosphoprotein associated with glycosphingolipid microdomains 1
chicken(420195) phosphoprotein associated with glycosphingolipid microdomains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018440 Rosetta Predictions human pricing
NM_022253 Rosetta Predictions rat pricing
NM_053182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169053 predicted 1644
2 SASI_Hs01_00169054 predicted 1577
3 SASI_Hs02_00351970 predicted 1884
4 SASI_Hs01_00169055 predicted 2087
5 SASI_Hs01_00169056 predicted 734
6 SASI_Hs01_00169057 predicted 1594
7 SASI_Hs01_00169058 predicted 1861
8 SASI_Hs01_00169059 predicted 1983
9 SASI_Hs01_00169060 predicted 2072
10 SASI_Hs01_00169061 predicted 1648
11 SASI_Hs01_00169062 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099563 predicted 1036
2 SASI_Rn01_00099564 predicted 1001
3 SASI_Rn01_00099565 predicted 1129
4 SASI_Rn01_00099566 predicted 781
5 SASI_Rn01_00099568 predicted 997
6 SASI_Rn01_00099569 predicted 610
7 SASI_Rn01_00099571 predicted 843
8 SASI_Rn02_00263042 predicted 572
9 SASI_Rn02_00263043 predicted 724
10 SASI_Rn02_00263044 predicted 952
11 SASI_Rn01_00099567 predicted 976
12 SASI_Rn01_00099570 predicted 941
13 SASI_Rn01_00099572 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024842 predicted 1917
2 SASI_Mm01_00024843 predicted 1572
3 SASI_Mm01_00024844 predicted 1431
4 SASI_Mm01_00024845 predicted 1117
5 SASI_Mm01_00024847 predicted 1459
6 SASI_Mm01_00024848 predicted 982
7 SASI_Mm01_00024849 predicted 1541
8 SASI_Mm01_00024850 predicted 1952
9 SASI_Mm01_00024851 predicted 1447
10 SASI_Mm02_00337738 predicted 1224
11 SASI_Mm01_00024846 predicted 1732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053182
PAG1 MISSION shRNA Bacterial Glycerol Stock
phosphoprotein associated with glycosphingolipid microdomains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1135s1c1
Sequence:CCGGGATCAAGGAAGTGGCAGACAACTCGAGTTGTCTGCCACTTCCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1802s1c1
Sequence:CCGGGAGAGTGACTACGAGAGCATTCTCGAGAATGCTCTCGTAGTCACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1174s1c1
Sequence:CCGGCAAGTCCACTTCTGCCTTGAACTCGAGTTCAAGGCAGAAGTGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053182.2-2564s1c1
Sequence:CCGGCCTTCCAAACAGAGCCTTAATCTCGAGATTAAGGCTCTGTTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1556s1c1
Sequence:CCGGCCATGTATGAAAGGGCCAGAACTCGAGTTCTGGCCCTTTCATACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053182
PAG1 MISSION shRNA shRNA Plasmid DNA
phosphoprotein associated with glycosphingolipid microdomains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1135s1c1
Sequence:CCGGGATCAAGGAAGTGGCAGACAACTCGAGTTGTCTGCCACTTCCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1802s1c1
Sequence:CCGGGAGAGTGACTACGAGAGCATTCTCGAGAATGCTCTCGTAGTCACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1174s1c1
Sequence:CCGGCAAGTCCACTTCTGCCTTGAACTCGAGTTCAAGGCAGAAGTGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053182.2-2564s1c1
Sequence:CCGGCCTTCCAAACAGAGCCTTAATCTCGAGATTAAGGCTCTGTTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1556s1c1
Sequence:CCGGCCATGTATGAAAGGGCCAGAACTCGAGTTCTGGCCCTTTCATACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053182
PAG1 MISSION shRNA Lentiviral Transduction Particles
phosphoprotein associated with glycosphingolipid microdomains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1135s1c1
Sequence:CCGGGATCAAGGAAGTGGCAGACAACTCGAGTTGTCTGCCACTTCCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1802s1c1
Sequence:CCGGGAGAGTGACTACGAGAGCATTCTCGAGAATGCTCTCGTAGTCACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1174s1c1
Sequence:CCGGCAAGTCCACTTCTGCCTTGAACTCGAGTTCAAGGCAGAAGTGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053182.2-2564s1c1
Sequence:CCGGCCTTCCAAACAGAGCCTTAATCTCGAGATTAAGGCTCTGTTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053182.2-1556s1c1
Sequence:CCGGCCATGTATGAAAGGGCCAGAACTCGAGTTCTGGCCCTTTCATACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018440
PAG1 MISSION shRNA Bacterial Glycerol Stock
phosphoprotein associated with glycosphingolipid microdomains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018440.3-5516s1c1
Sequence:CCGGCCGCATTATATCACTGTATATCTCGAGATATACAGTGATATAATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1435s1c1
Sequence:CCGGGTAGAGAGTATCCTTGGAAATCTCGAGATTTCCAAGGATACTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1772s1c1
Sequence:CCGGCCTGTAATGATCTCTATGCTACTCGAGTAGCATAGAGATCATTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1779s1c1
Sequence:CCGGTGATCTCTATGCTACTGTTAACTCGAGTTAACAGTAGCATAGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1678s1c1
Sequence:CCGGCCTGGACAGTTAGTGAATAAACTCGAGTTTATTCACTAACTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1496s21c1
Sequence:CCGGTTAAGCTTCTGGACGAGAATGCTCGAGCATTCTCGTCCAGAAGCTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-903s21c1
Sequence:CCGGGATGTTCAGCCGTTCAGTTACCTCGAGGTAACTGAACGGCTGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1655s21c1
Sequence:CCGGCTATGTACTCATCAGTAAATACTCGAGTATTTACTGATGAGTACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1953s21c1
Sequence:CCGGGAACGACTACGAGAGCATAAGCTCGAGCTTATGCTCTCGTAGTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018440
PAG1 MISSION shRNA shRNA Plasmid DNA
phosphoprotein associated with glycosphingolipid microdomains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018440.3-5516s1c1
Sequence:CCGGCCGCATTATATCACTGTATATCTCGAGATATACAGTGATATAATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1435s1c1
Sequence:CCGGGTAGAGAGTATCCTTGGAAATCTCGAGATTTCCAAGGATACTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1772s1c1
Sequence:CCGGCCTGTAATGATCTCTATGCTACTCGAGTAGCATAGAGATCATTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1779s1c1
Sequence:CCGGTGATCTCTATGCTACTGTTAACTCGAGTTAACAGTAGCATAGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1678s1c1
Sequence:CCGGCCTGGACAGTTAGTGAATAAACTCGAGTTTATTCACTAACTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1496s21c1
Sequence:CCGGTTAAGCTTCTGGACGAGAATGCTCGAGCATTCTCGTCCAGAAGCTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-903s21c1
Sequence:CCGGGATGTTCAGCCGTTCAGTTACCTCGAGGTAACTGAACGGCTGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1655s21c1
Sequence:CCGGCTATGTACTCATCAGTAAATACTCGAGTATTTACTGATGAGTACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1953s21c1
Sequence:CCGGGAACGACTACGAGAGCATAAGCTCGAGCTTATGCTCTCGTAGTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018440
PAG1 MISSION shRNA Lentiviral Transduction Particles
phosphoprotein associated with glycosphingolipid microdomains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018440.3-5516s1c1
Sequence:CCGGCCGCATTATATCACTGTATATCTCGAGATATACAGTGATATAATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1435s1c1
Sequence:CCGGGTAGAGAGTATCCTTGGAAATCTCGAGATTTCCAAGGATACTCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1772s1c1
Sequence:CCGGCCTGTAATGATCTCTATGCTACTCGAGTAGCATAGAGATCATTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1779s1c1
Sequence:CCGGTGATCTCTATGCTACTGTTAACTCGAGTTAACAGTAGCATAGAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018440.3-1678s1c1
Sequence:CCGGCCTGGACAGTTAGTGAATAAACTCGAGTTTATTCACTAACTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1496s21c1
Sequence:CCGGTTAAGCTTCTGGACGAGAATGCTCGAGCATTCTCGTCCAGAAGCTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-903s21c1
Sequence:CCGGGATGTTCAGCCGTTCAGTTACCTCGAGGTAACTGAACGGCTGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1655s21c1
Sequence:CCGGCTATGTACTCATCAGTAAATACTCGAGTATTTACTGATGAGTACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018440.3-1953s21c1
Sequence:CCGGGAACGACTACGAGAGCATAAGCTCGAGCTTATGCTCTCGTAGTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)