EMAIL THIS PAGE TO A FRIEND

PAH

phenylalanine hydroxylase

75 Gene Product Result for
Synonyms: PH PKU PKU1
UniProtKB ID: P00439, Q16717, Q8TC14
Gene ID:
Human(5053) Summary: PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
Mouse(18478) phenylalanine hydroxylase
Rat(24616) phenylalanine hydroxylase
sheep(101110405) phenylalanine hydroxylase
domestic guinea pig(100719535) phenylalanine hydroxylase
naked mole-rat(101705870) phenylalanine hydroxylase
Domestic Rabbit(100354678) phenylalanine hydroxylase
Zebrafish(378962) phenylalanine hydroxylase
chicken(408024) phenylalanine hydroxylase
cow(510583) phenylalanine hydroxylase
Horse(100053361) phenylalanine hydroxylase
domestic cat(101081741) phenylalanine hydroxylase
dog(475446) phenylalanine hydroxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006911 MISSION® esiRNA esiRNA targeting human PAH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000277 Rosetta Predictions human pricing
NM_012619 Rosetta Predictions rat pricing
NM_008777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021775 predicted 1469
2 SASI_Hs01_00021776 predicted 542
3 SASI_Hs01_00021778 predicted 1068
4 SASI_Hs01_00021779 predicted 1735
5 SASI_Hs01_00021781 predicted 1438
6 SASI_Hs01_00021782 predicted 602
7 SASI_Hs01_00021783 predicted 1035
8 SASI_Hs02_00302234 predicted 660
9 SASI_Hs02_00302235 predicted 1431
10 SASI_Hs02_00302236 predicted 1309
11 SASI_Hs01_00021774 predicted 1785
12 SASI_Hs01_00021777 predicted 856
13 SASI_Hs01_00021780 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098922 predicted 260
2 SASI_Rn01_00098923 predicted 1490
3 SASI_Rn01_00098924 predicted 306
4 SASI_Rn01_00098926 predicted 1326
5 SASI_Rn01_00098927 predicted 1048
6 SASI_Rn02_00259820 predicted 476
7 SASI_Rn01_00098929 predicted 1230
8 SASI_Rn02_00259821 predicted 665
9 SASI_Rn02_00259822 predicted 1227
10 SASI_Rn02_00259823 predicted 992
11 SASI_Rn01_00098925 predicted 1479
12 SASI_Rn01_00098928 predicted 1034
13 SASI_Rn01_00098930 predicted 475
14 SASI_Rn01_00098931 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028173 predicted 898
2 SASI_Mm01_00028174 predicted 389
3 SASI_Mm01_00028175 predicted 1189
4 SASI_Mm01_00028176 predicted 1600
5 SASI_Mm01_00028177 predicted 614
6 SASI_Mm01_00028178 predicted 1029
7 SASI_Mm01_00028180 predicted 1630
8 SASI_Mm02_00314669 predicted 313
9 SASI_Mm01_00028182 predicted 955
10 SASI_Mm02_00314670 predicted 1587
11 SASI_Mm01_00028179 predicted 267
12 SASI_Mm01_00028181 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008777
PAH MISSION shRNA Bacterial Glycerol Stock
phenylalanine hydroxylase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008777.1-885s1c1
Sequence:CCGGGAACCTGATATCTGTCATGAACTCGAGTTCATGACAGATATCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-200s1c1
Sequence:CCGGCCTGCGCTTATTTGAGGAGAACTCGAGTTCTCCTCAAATAAGCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008777.1-1644s1c1
Sequence:CCGGCAGACCTTCAATTTGGTTTAACTCGAGTTAAACCAAATTGAAGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-1008s1c1
Sequence:CCGGCTGGCCACAATTTACTGGTTTCTCGAGAAACCAGTAAATTGTGGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-519s1c1
Sequence:CCGGCGAAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-857s1c1
Sequence:CCGGGCATGGATCTAAGCCCATGTACTCGAGTACATGGGCTTAGATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008777.1-1467s1c1
Sequence:CCGGGAAGTATAGTAACTGCTTCTTCTCGAGAAGAAGCAGTTACTATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008777
PAH MISSION shRNA shRNA Plasmid DNA
phenylalanine hydroxylase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008777.1-885s1c1
Sequence:CCGGGAACCTGATATCTGTCATGAACTCGAGTTCATGACAGATATCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-200s1c1
Sequence:CCGGCCTGCGCTTATTTGAGGAGAACTCGAGTTCTCCTCAAATAAGCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008777.1-1644s1c1
Sequence:CCGGCAGACCTTCAATTTGGTTTAACTCGAGTTAAACCAAATTGAAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-1008s1c1
Sequence:CCGGCTGGCCACAATTTACTGGTTTCTCGAGAAACCAGTAAATTGTGGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-519s1c1
Sequence:CCGGCGAAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-857s1c1
Sequence:CCGGGCATGGATCTAAGCCCATGTACTCGAGTACATGGGCTTAGATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008777.1-1467s1c1
Sequence:CCGGGAAGTATAGTAACTGCTTCTTCTCGAGAAGAAGCAGTTACTATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008777
PAH MISSION shRNA Lentiviral Transduction Particles
phenylalanine hydroxylase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008777.1-885s1c1
Sequence:CCGGGAACCTGATATCTGTCATGAACTCGAGTTCATGACAGATATCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-200s1c1
Sequence:CCGGCCTGCGCTTATTTGAGGAGAACTCGAGTTCTCCTCAAATAAGCGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008777.1-1644s1c1
Sequence:CCGGCAGACCTTCAATTTGGTTTAACTCGAGTTAAACCAAATTGAAGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-1008s1c1
Sequence:CCGGCTGGCCACAATTTACTGGTTTCTCGAGAAACCAGTAAATTGTGGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-519s1c1
Sequence:CCGGCGAAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008777.1-857s1c1
Sequence:CCGGGCATGGATCTAAGCCCATGTACTCGAGTACATGGGCTTAGATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008777.1-1467s1c1
Sequence:CCGGGAAGTATAGTAACTGCTTCTTCTCGAGAAGAAGCAGTTACTATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000277
PAH MISSION shRNA Bacterial Glycerol Stock
phenylalanine hydroxylase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-944s1c1
Sequence:CCGGCGGAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-998s1c1
Sequence:CCGGCGAGTGGAATACATGGAGGAACTCGAGTTCCTCCATGTATTCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1779s1c1
Sequence:CCGGCCATTAACAGTGAAATTGGAACTCGAGTTCCAATTTCACTGTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-617s1c1
Sequence:CCGGGCCAAAGTATTGCGCTTATTTCTCGAGAAATAAGCGCAATACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1473s1c1
Sequence:CCGGGCAAACAAGGAGACTCCATAACTCGAGTTATGGAGTCTCCTTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-790s21c1
Sequence:CCGGCCATGAGCTTTCACGAGATAACTCGAGTTATCTCGTGAAAGCTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2102s21c1
Sequence:CCGCTCGCATTTCATCAAGATTAATCTCGAGATTAATCTTGATGAAATGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2172s21c1
Sequence:CCGGACTCATAAAGGAGCATATAAGCTCGAGCTTATATGCTCCTTTATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-671s21c1
Sequence:CCGGTCTAGACCTTCTCGTTTAAAGCTCGAGCTTTAAACGAGAAGGTCTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000277
PAH MISSION shRNA shRNA Plasmid DNA
phenylalanine hydroxylase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-944s1c1
Sequence:CCGGCGGAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-998s1c1
Sequence:CCGGCGAGTGGAATACATGGAGGAACTCGAGTTCCTCCATGTATTCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1779s1c1
Sequence:CCGGCCATTAACAGTGAAATTGGAACTCGAGTTCCAATTTCACTGTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-617s1c1
Sequence:CCGGGCCAAAGTATTGCGCTTATTTCTCGAGAAATAAGCGCAATACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1473s1c1
Sequence:CCGGGCAAACAAGGAGACTCCATAACTCGAGTTATGGAGTCTCCTTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-790s21c1
Sequence:CCGGCCATGAGCTTTCACGAGATAACTCGAGTTATCTCGTGAAAGCTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2102s21c1
Sequence:CCGCTCGCATTTCATCAAGATTAATCTCGAGATTAATCTTGATGAAATGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2172s21c1
Sequence:CCGGACTCATAAAGGAGCATATAAGCTCGAGCTTATATGCTCCTTTATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-671s21c1
Sequence:CCGGTCTAGACCTTCTCGTTTAAAGCTCGAGCTTTAAACGAGAAGGTCTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000277
PAH MISSION shRNA Lentiviral Transduction Particles
phenylalanine hydroxylase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-944s1c1
Sequence:CCGGCGGAAGCAGTTTGCTGACATTCTCGAGAATGTCAGCAAACTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-998s1c1
Sequence:CCGGCGAGTGGAATACATGGAGGAACTCGAGTTCCTCCATGTATTCCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1779s1c1
Sequence:CCGGCCATTAACAGTGAAATTGGAACTCGAGTTCCAATTTCACTGTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-617s1c1
Sequence:CCGGGCCAAAGTATTGCGCTTATTTCTCGAGAAATAAGCGCAATACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000277.1-1473s1c1
Sequence:CCGGGCAAACAAGGAGACTCCATAACTCGAGTTATGGAGTCTCCTTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-790s21c1
Sequence:CCGGCCATGAGCTTTCACGAGATAACTCGAGTTATCTCGTGAAAGCTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2102s21c1
Sequence:CCGCTCGCATTTCATCAAGATTAATCTCGAGATTAATCTTGATGAAATGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000277.1-2172s21c1
Sequence:CCGGACTCATAAAGGAGCATATAAGCTCGAGCTTATATGCTCCTTTATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000277.1-671s21c1
Sequence:CCGGTCTAGACCTTCTCGTTTAAAGCTCGAGCTTTAAACGAGAAGGTCTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)