EMAIL THIS PAGE TO A FRIEND

PAIP2B

poly(A) binding protein interacting protein 2B

76 Gene Product Result for
UniProtKB ID: Q9ULR5
Gene ID:
Human(400961) Summary: Most mRNAs, except for histones, contain a 3-prime poly(A) tail. Poly(A)-binding protein (PABP; see MIM 604679) enhances translation by circularizing mRNA through its interaction with the translation initiation factor EIF4G1 (MIM 600495) and the poly(A) tail. Various PABP-binding proteins regulate PABP activity, including PAIP1 (MIM 605184), a translational stimulator, and PAIP2A (MIM 605604) and PAIP2B, translational inhibitors (Derry et al., 2006 [PubMed 17381337]
Mouse(232164) poly(A) binding protein interacting protein 2B
Rat(312490) poly(A) binding protein interacting protein 2B
domestic guinea pig(100723173) poly(A) binding protein interacting protein 2B
naked mole-rat(101719245) poly(A) binding protein interacting protein 2B
sheep(101108470) poly(A) binding protein interacting protein 2B
Zebrafish(393739) poly(A) binding protein interacting protein 2B
cow(789468) poly(A) binding protein interacting protein 2B
domestic cat(101099038) poly(A) binding protein interacting protein 2B
dog(475800) poly(A) binding protein interacting protein 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029611 MISSION® esiRNA esiRNA human PAIP2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020459 Rosetta Predictions human pricing
XM_376062 Rosetta Predictions human pricing
XM_930404 Rosetta Predictions human pricing
XM_001073206 Rosetta Predictions rat pricing
XM_232121 Rosetta Predictions rat pricing
NM_146169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353507 predicted 465
2 SASI_Hs02_00353508 predicted 439
3 SASI_Hs02_00353509 predicted 444
4 SASI_Hs02_00353510 predicted 438
5 SASI_Hs02_00353511 predicted 399
6 SASI_Hs02_00353512 predicted 1012
7 SASI_Hs02_00353513 predicted 394
8 SASI_Hs02_00353514 predicted 428
9 SASI_Hs02_00353515 predicted 433
10 SASI_Hs02_00353516 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283624 predicted 455
2 SASI_Hs01_00283625 predicted 447
3 SASI_Hs01_00283626 predicted 418
4 SASI_Hs01_00283627 predicted 430
5 SASI_Hs01_00283628 predicted 421
6 SASI_Hs01_00283629 predicted 219
7 SASI_Hs01_00283630 predicted 374
8 SASI_Hs01_00283631 predicted 991
9 SASI_Hs01_00283632 predicted 375
10 SASI_Hs01_00283633 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285704 predicted 384
2 SASI_Hs01_00285705 predicted 387
3 SASI_Hs01_00285706 predicted 378
4 SASI_Hs01_00285707 predicted 337
5 SASI_Hs01_00285708 predicted 350
6 SASI_Hs01_00285709 predicted 343
7 SASI_Hs01_00285710 predicted 302
8 SASI_Hs01_00285711 predicted 349
9 SASI_Hs01_00285712 predicted 297
10 SASI_Hs01_00285713 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341910 predicted 474
2 SASI_Rn02_00341911 predicted 821
3 SASI_Rn02_00341912 predicted 464
4 SASI_Rn02_00341913 predicted 531
5 SASI_Rn02_00341914 predicted 751
6 SASI_Rn02_00341915 predicted 696
7 SASI_Rn02_00341916 predicted 968
8 SASI_Rn02_00341917 predicted 251
9 SASI_Rn02_00341918 predicted 729
10 SASI_Rn02_00341919 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386991 predicted 950
2 SASI_Rn02_00386992 predicted 1001
3 SASI_Rn02_00386993 predicted 956
4 SASI_Rn02_00386994 predicted 965
5 SASI_Rn02_00386995 predicted 950
6 SASI_Rn02_00386996 predicted 948
7 SASI_Rn02_00386997 predicted 1005
8 SASI_Rn02_00386998 predicted 947
9 SASI_Rn02_00386999 predicted 952
10 SASI_Rn02_00387000 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341865 predicted 231
2 SASI_Mm01_00049951 predicted 797
3 SASI_Mm01_00049953 predicted 425
4 SASI_Mm02_00341866 predicted 420
5 SASI_Mm01_00049954 predicted 939
6 SASI_Mm01_00049956 predicted 437
7 SASI_Mm02_00341867 predicted 1035
8 SASI_Mm02_00341868 predicted 937
9 SASI_Mm02_00341869 predicted 424
10 SASI_Mm02_00341870 predicted 695
11 SASI_Mm01_00049950 predicted 967
12 SASI_Mm01_00049952 predicted 807
13 SASI_Mm01_00049955 predicted 376
14 SASI_Mm01_00049957 predicted 876
15 SASI_Mm01_00049958 predicted 693
16 SASI_Mm01_00049959 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146169
VALIDATED
PAIP2B MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein interacting protein 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-150s1c1
Sequence:CCGGGACCAAGGATTAAATGGACATCTCGAGATGTCCATTTAATCCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-88s1c1
Sequence:CCGGGAATCTCCATAATGAATGGATCTCGAGATCCATTCATTATGGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-357s1c1
Sequence:CCGGCAACAGCAGTTAAATGGACTACTCGAGTAGTCCATTTAACTGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-468s21c1
Sequence:CCGGGTCATGAATCTGAAGACATTTCTCGAGAAATGTCTTCAGATTCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-507s21c1
Sequence:CCGGATCCAGATGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCATCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-198s21c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-2944s21c1
Sequence:CCGGGTGATTATTTGACCCTATTAACTCGAGTTAATAGGGTCAAATAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.2-198s1c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146169.2-1405s1c1
Sequence:CCGGGATGTCTTAATTCCCTTATATCTCGAGATATAAGGGAATTAAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-428s21c1
Sequence:CCGGCACTTACAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146169
VALIDATED
PAIP2B MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein interacting protein 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-150s1c1
Sequence:CCGGGACCAAGGATTAAATGGACATCTCGAGATGTCCATTTAATCCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-88s1c1
Sequence:CCGGGAATCTCCATAATGAATGGATCTCGAGATCCATTCATTATGGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-357s1c1
Sequence:CCGGCAACAGCAGTTAAATGGACTACTCGAGTAGTCCATTTAACTGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-468s21c1
Sequence:CCGGGTCATGAATCTGAAGACATTTCTCGAGAAATGTCTTCAGATTCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-507s21c1
Sequence:CCGGATCCAGATGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCATCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-198s21c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-2944s21c1
Sequence:CCGGGTGATTATTTGACCCTATTAACTCGAGTTAATAGGGTCAAATAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.2-198s1c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146169.2-1405s1c1
Sequence:CCGGGATGTCTTAATTCCCTTATATCTCGAGATATAAGGGAATTAAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-428s21c1
Sequence:CCGGCACTTACAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146169
VALIDATED
PAIP2B MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein interacting protein 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-150s1c1
Sequence:CCGGGACCAAGGATTAAATGGACATCTCGAGATGTCCATTTAATCCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-88s1c1
Sequence:CCGGGAATCTCCATAATGAATGGATCTCGAGATCCATTCATTATGGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.1-357s1c1
Sequence:CCGGCAACAGCAGTTAAATGGACTACTCGAGTAGTCCATTTAACTGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-468s21c1
Sequence:CCGGGTCATGAATCTGAAGACATTTCTCGAGAAATGTCTTCAGATTCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-507s21c1
Sequence:CCGGATCCAGATGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCATCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-198s21c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-2944s21c1
Sequence:CCGGGTGATTATTTGACCCTATTAACTCGAGTTAATAGGGTCAAATAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146169.2-198s1c1
Sequence:CCGGGTACATCACCCAGTGTGAAATCTCGAGATTTCACACTGGGTGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146169.2-1405s1c1
Sequence:CCGGGATGTCTTAATTCCCTTATATCTCGAGATATAAGGGAATTAAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146169.2-428s21c1
Sequence:CCGGCACTTACAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020459
VALIDATED
PAIP2B MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein interacting protein 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-521s21c1
Sequence:CCGGCCAGATGCCAAGGAGTTTATTCTCGAGAATAAACTCCTTGGCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020459.1-4228s21c1
Sequence:CCGGGGGATAACGCGGACGTCATTACTCGAGTAATGACGTCCGCGTTATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-440s21c1
Sequence:CCGGCAGTTGCAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-389s21c1
Sequence:CCGGGAAGACCAAGACTGGTTTATTCTCGAGAATAAACCAGTCTTGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020459.1-469s21c1
Sequence:CCGGAGTCAGTGAAGGTCATGATTCCTCGAGGAATCATGACCTTCACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020459
VALIDATED
PAIP2B MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein interacting protein 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-521s21c1
Sequence:CCGGCCAGATGCCAAGGAGTTTATTCTCGAGAATAAACTCCTTGGCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020459.1-4228s21c1
Sequence:CCGGGGGATAACGCGGACGTCATTACTCGAGTAATGACGTCCGCGTTATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-440s21c1
Sequence:CCGGCAGTTGCAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-389s21c1
Sequence:CCGGGAAGACCAAGACTGGTTTATTCTCGAGAATAAACCAGTCTTGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020459.1-469s21c1
Sequence:CCGGAGTCAGTGAAGGTCATGATTCCTCGAGGAATCATGACCTTCACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020459
VALIDATED
PAIP2B MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein interacting protein 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-521s21c1
Sequence:CCGGCCAGATGCCAAGGAGTTTATTCTCGAGAATAAACTCCTTGGCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020459.1-4228s21c1
Sequence:CCGGGGGATAACGCGGACGTCATTACTCGAGTAATGACGTCCGCGTTATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-440s21c1
Sequence:CCGGCAGTTGCAACAGCAGTTAAATCTCGAGATTTAACTGCTGTTGCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020459.1-389s21c1
Sequence:CCGGGAAGACCAAGACTGGTTTATTCTCGAGAATAAACCAGTCTTGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020459.1-469s21c1
Sequence:CCGGAGTCAGTGAAGGTCATGATTCCTCGAGGAATCATGACCTTCACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)