EMAIL THIS PAGE TO A FRIEND

PAK1

p21 protein (Cdc42/Rac)-activated kinase 1

100 Gene Product Result for
Synonyms: PAKalpha
UniProtKB ID: Q13153, O75561, Q13567, Q32M53, Q32M54, Q86W79
Gene ID:
Human(5058) Summary: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(18479) p21 protein (Cdc42/Rac)-activated kinase 1
Rat(29431) p21 protein (Cdc42/Rac)-activated kinase 1
Zebrafish(373103) p21/Cdc42/Rac1-activated kinase 1
domestic cat(101087171) p21 protein (Cdc42/Rac)-activated kinase 1
cow(533729) p21 protein (Cdc42/Rac)-activated kinase 1
dog(607885) p21 protein (Cdc42/Rac)-activated kinase 1
chicken(419083) p21 protein (Cdc42/Rac)-activated kinase 1
domestic guinea pig(100714662) p21 protein (Cdc42/Rac)-activated kinase 1
naked mole-rat(101713465) p21 protein (Cdc42/Rac)-activated kinase 1
sheep(101111756) p21 protein (Cdc42/Rac)-activated kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304715 ANTI-MOUSE PAK1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
K2140 Anti-PAK1 (148-160) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300427 Anti-PAK1 (Ab-212) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500741 Anti-PAK1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, mouse, human
ELISA, western blot pricing
SAB1406219 Anti-PAK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA003565 Anti-PAK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502062 Anti-PAK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502063 Anti-PAK1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502064 Anti-PAK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4502065 Anti-PAK1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502066 Anti-PAK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300434 Anti-PAK1/PAK2/PAK3 (Ab-423/402/421) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry pricing
SAB4504263 Anti-phospho-PAK1 (pSer199) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301266 Anti-phospho-PAK1 (pSer199) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504632 Anti-phospho-PAK1 (pSer204) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301308 Anti-phospho-PAK1 (pSer204) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300127 Anti-phospho-PAK1 (pThr212) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503962 Anti-phospho-PAK1 (pThr212) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
P7871 Anti-phospho-PAK1/2/3 (pSer141) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4503964 Anti-phospho-PAK1/2/3 (pSer144/141/139) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
P7746 Anti-phospho-PAK1/2/3 (pThr423) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4503963 Anti-phospho-PAK1/2/3 (pThr423/402/421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4300135 Anti-phospho-PAK1/PAK2/PAK3 (pThr423/pThr402/pThr421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry pricing
WH0005058M1 Monoclonal Anti-PAK1 antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400193 Monoclonal Anti-PAK1 antibody produced in mouse clone 4D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
P3237 Monoclonal Anti-phospho-PAK1 (pThr212) antibody produced in mouse ~2 mg/mL, clone PK-18, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002576 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
09-258 Anti-phospho-PAK1 (Ser199/Ser204) Antibody Detect phospho-PAK1 (Ser199/Ser204) using this Anti-phospho-PAK1 (Ser199/Ser204) Antibody validated for use in WB. pricing
07-1464 Anti-Rac1 Antibody Anti-Rac1 Antibody is an antibody against Rac1 for use in WB. pricing
16-637 Anti-Rac1 Antibody, clone 23A8, Agarose conjugate Detect Rac1 using this Anti-Rac1 Antibody, clone 23A8, Agarose conjugate validated for use in IP. pricing
09-271 Anti-Rac1b Antibody Detect Rac1b using this Anti-Rac1b Antibody validated for use in WB, IH(P) & IF. pricing
FCMAB330F Milli-Mark™ Anti-Rac1-FITC Antibody, clone 23A8 Milli-Mark Anti-Rac1-FITC Antibody, clone 23A8 detects level of Rac1 & has been published & validated for use in FC. pricing
14-864 PAK-1 PBD Protein (agarose free), 300 µg For use in Affinity Binding Assays, ELISA & G-Protein Assays. pricing
14-927-M PAK1 Protein, active, 10 µg Active, N-terminal FLAG-tagged, recombinant, human PAK1, amino acids 150-end. For use in Kinase Assays. pricing
17-283 Rac1 Activation Assay Kit Non-radioactive Rac1 Activation Assay Kit can be used to precipitate Rac1-GTP from cell lysates & detection by a Rac1 specific monoclonal antibody. pricing
17-10393 Rac1 Activation Magnetic Beads Pulldown Assay Non-radioactive Rac1 Activation Assay Kit can be used to precipitate Rac1-GTP from cell lysates, & detection by a Rac1 specific monoclonal antibody. pricing
17-441 Rac1/Cdc42 Activation Assay Kit The Rac1/Cdc42 Activation Assay provides an effective method for detecting Rac & Cdc42 activity in cell lysates. pricing
17-10394 Rac1/cdc42 Activation Magnetic Beads Pulldown Assay The Rac1/cdc42 Activation Magnetic Beads Pulldown Assay provides an effective method for detecting Rac & Cdc42 activity in cell lysates with higher yield & easier process utilizing magenetic bead properties. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002576 Rosetta Predictions human pricing
NM_017198 Rosetta Predictions rat pricing
NM_011035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087968 predicted 557
2 SASI_Hs02_00334074 predicted 1905
3 SASI_Hs01_00087970 predicted 1331
4 SASI_Hs01_00087971 predicted 1887
5 SASI_Hs01_00087972 predicted 600
6 SASI_Hs01_00087973 predicted 1437
7 SASI_Hs01_00087974 predicted 1425
8 SASI_Hs01_00087975 predicted 1242
9 SASI_Hs01_00087976 predicted 1565
10 SASI_Hs02_00334075 predicted 2040
11 SASI_Hs01_00087969 predicted 1522
12 SASI_Hs01_00087977 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090803 predicted 1298
2 SASI_Rn01_00090804 predicted 1734
3 SASI_Rn01_00090805 predicted 1571
4 SASI_Rn01_00090806 predicted 536
5 SASI_Rn01_00090807 predicted 2065
6 SASI_Rn01_00090808 predicted 625
7 SASI_Rn01_00090809 predicted 485
8 SASI_Rn01_00090811 predicted 1124
9 SASI_Rn01_00090812 predicted 1039
10 SASI_Rn02_00261556 predicted 1519
11 SASI_Rn01_00090810 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186325 predicted 1566
2 SASI_Mm01_00186327 predicted 1232
3 SASI_Mm02_00319777 predicted 1219
4 SASI_Mm01_00186328 predicted 1138
5 SASI_Mm01_00186329 predicted 1390
6 SASI_Mm02_00319778 predicted 634
7 SASI_Mm01_00186330 predicted 1105
8 SASI_Mm01_00186332 predicted 469
9 SASI_Mm01_00186333 predicted 1409
10 SASI_Mm01_00186334 predicted 964
11 SASI_Mm01_00186326 predicted 1504
12 SASI_Mm01_00186331 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011035
VALIDATED
PAK1 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-622s21c1
Sequence:CCGGACTCTAAGAAGACCTCCAATACTCGAGTATTGGAGGTCTTCTTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1060s21c1
Sequence:CCGGGTGCTTCAGGCACAGTGTATACTCGAGTATACACTGTGCCTGAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011035.2-2209s21c1
Sequence:CCGGGTTTGATAGCATTATCGATTTCTCGAGAAATCGATAATGCTATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1390s21c1
Sequence:CCGGACATCAAGAGTGACAATATTCCTCGAGGAATATTGTCACTCTTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1491s21c1
Sequence:CCGGACCATGGTGGGAACTCCATATCTCGAGATATGGAGTTCCCACCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-670s21c1
Sequence:CCGGAGTCAGCTGAAGATTATAATTCTCGAGAATTATAATCTTCAGCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1647s1c1
Sequence:CCGGCCCAGAGAAGTTGTCAGCTATCTCGAGATAGCTGACAACTTCTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1108s1c1
Sequence:CCGGCCGAAGAAAGAGCTGATTATTCTCGAGAATAATCAGCTCTTTCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1003s1c1
Sequence:CCGGCCGTTCGAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTCGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-597s1c1
Sequence:CCGGCTCCAATAGTAAGAAGTACATCTCGAGATGTACTTCTTACTATTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011035.1-1206s1c1
Sequence:CCGGGCTGTGGGTTGTTATGGAATACTCGAGTATTCCATAACAACCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011035
VALIDATED
PAK1 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-622s21c1
Sequence:CCGGACTCTAAGAAGACCTCCAATACTCGAGTATTGGAGGTCTTCTTAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1060s21c1
Sequence:CCGGGTGCTTCAGGCACAGTGTATACTCGAGTATACACTGTGCCTGAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011035.2-2209s21c1
Sequence:CCGGGTTTGATAGCATTATCGATTTCTCGAGAAATCGATAATGCTATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1390s21c1
Sequence:CCGGACATCAAGAGTGACAATATTCCTCGAGGAATATTGTCACTCTTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1491s21c1
Sequence:CCGGACCATGGTGGGAACTCCATATCTCGAGATATGGAGTTCCCACCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-670s21c1
Sequence:CCGGAGTCAGCTGAAGATTATAATTCTCGAGAATTATAATCTTCAGCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1647s1c1
Sequence:CCGGCCCAGAGAAGTTGTCAGCTATCTCGAGATAGCTGACAACTTCTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1108s1c1
Sequence:CCGGCCGAAGAAAGAGCTGATTATTCTCGAGAATAATCAGCTCTTTCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1003s1c1
Sequence:CCGGCCGTTCGAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTCGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-597s1c1
Sequence:CCGGCTCCAATAGTAAGAAGTACATCTCGAGATGTACTTCTTACTATTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011035.1-1206s1c1
Sequence:CCGGGCTGTGGGTTGTTATGGAATACTCGAGTATTCCATAACAACCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011035
VALIDATED
PAK1 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-622s21c1
Sequence:CCGGACTCTAAGAAGACCTCCAATACTCGAGTATTGGAGGTCTTCTTAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1060s21c1
Sequence:CCGGGTGCTTCAGGCACAGTGTATACTCGAGTATACACTGTGCCTGAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011035.2-2209s21c1
Sequence:CCGGGTTTGATAGCATTATCGATTTCTCGAGAAATCGATAATGCTATCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1390s21c1
Sequence:CCGGACATCAAGAGTGACAATATTCCTCGAGGAATATTGTCACTCTTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-1491s21c1
Sequence:CCGGACCATGGTGGGAACTCCATATCTCGAGATATGGAGTTCCCACCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011035.2-670s21c1
Sequence:CCGGAGTCAGCTGAAGATTATAATTCTCGAGAATTATAATCTTCAGCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1647s1c1
Sequence:CCGGCCCAGAGAAGTTGTCAGCTATCTCGAGATAGCTGACAACTTCTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1108s1c1
Sequence:CCGGCCGAAGAAAGAGCTGATTATTCTCGAGAATAATCAGCTCTTTCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-1003s1c1
Sequence:CCGGCCGTTCGAGAAGATTGGACAACTCGAGTTGTCCAATCTTCTCGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011035.1-597s1c1
Sequence:CCGGCTCCAATAGTAAGAAGTACATCTCGAGATGTACTTCTTACTATTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011035.1-1206s1c1
Sequence:CCGGGCTGTGGGTTGTTATGGAATACTCGAGTATTCCATAACAACCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002576
VALIDATED
PAK1 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1453s21c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1673s21c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1324s21c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-631s21c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1655s1c1
Sequence:CCGGCCAGAGGTTGTGACACGAAAGCTCGAGCTTTCGTGTCACAACCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-2548s1c1
Sequence:CCGGCATGGGAGAACAACCACATTTCTCGAGAAATGTGGTTGTTCTCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-456s1c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1898s1c1
Sequence:CCGGGAGCTGCTACAGCATCAATTCCTCGAGGAATTGATGCTGTAGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1498s1c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1313s1c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-2127s1c1
Sequence:CCGGCTTCTCCCATTTCCTGATCTACTCGAGTAGATCAGGAAATGGGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002576.x-440s1c1
Sequence:CCGGCGATGAGAAATACCAGCACTACTCGAGTAGTGCTGGTATTTCTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1184s1c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002576
VALIDATED
PAK1 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1453s21c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1673s21c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1324s21c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-631s21c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1655s1c1
Sequence:CCGGCCAGAGGTTGTGACACGAAAGCTCGAGCTTTCGTGTCACAACCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-2548s1c1
Sequence:CCGGCATGGGAGAACAACCACATTTCTCGAGAAATGTGGTTGTTCTCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-456s1c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1898s1c1
Sequence:CCGGGAGCTGCTACAGCATCAATTCCTCGAGGAATTGATGCTGTAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1498s1c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1313s1c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-2127s1c1
Sequence:CCGGCTTCTCCCATTTCCTGATCTACTCGAGTAGATCAGGAAATGGGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002576.x-440s1c1
Sequence:CCGGCGATGAGAAATACCAGCACTACTCGAGTAGTGCTGGTATTTCTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1184s1c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002576
VALIDATED
PAK1 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1453s21c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1673s21c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-1324s21c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002576.4-631s21c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1655s1c1
Sequence:CCGGCCAGAGGTTGTGACACGAAAGCTCGAGCTTTCGTGTCACAACCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-2548s1c1
Sequence:CCGGCATGGGAGAACAACCACATTTCTCGAGAAATGTGGTTGTTCTCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-456s1c1
Sequence:CCGGCCCTAAACCATGGTTCTAAACCTCGAGGTTTAGAACCATGGTTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1898s1c1
Sequence:CCGGGAGCTGCTACAGCATCAATTCCTCGAGGAATTGATGCTGTAGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002576.3-1498s1c1
Sequence:CCGGGCATTCGAACCAGGTCATTCACTCGAGTGAATGACCTGGTTCGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1313s1c1
Sequence:CCGGCCAAGAAAGAGCTGATTATTACTCGAGTAATAATCAGCTCTTTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-2127s1c1
Sequence:CCGGCTTCTCCCATTTCCTGATCTACTCGAGTAGATCAGGAAATGGGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002576.x-440s1c1
Sequence:CCGGCGATGAGAAATACCAGCACTACTCGAGTAGTGCTGGTATTTCTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002576.x-1184s1c1
Sequence:CCGGGCGATCCTAAGAAGAAATATACTCGAGTATATTTCTTCTTAGGATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)