EMAIL THIS PAGE TO A FRIEND

PAK2

p21 protein (Cdc42/Rac)-activated kinase 2

53 Gene Product Result for
Synonyms: PAK65 PAKgamma
UniProtKB ID: Q13177, Q13154, Q6ISC3
Gene ID:
Human(5062) Summary: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell. [provided by RefSeq, Jul 2008]
Mouse(224105) p21 protein (Cdc42/Rac)-activated kinase 2
Rat(29432) p21 protein (Cdc42/Rac)-activated kinase 2
chicken(424860) p21 protein (Cdc42/Rac)-activated kinase 2
dog(612814) p21 protein (Cdc42/Rac)-activated kinase 2
domestic cat(101082845) p21 protein (Cdc42/Rac)-activated kinase 2
cow(513673) p21 protein (Cdc42/Rac)-activated kinase 2
domestic guinea pig(100713135) p21 protein (Cdc42/Rac)-activated kinase 2
naked mole-rat(101710712) p21 protein (Cdc42/Rac)-activated kinase 2
Domestic Rabbit(100009535) p21 protein (Cdc42/Rac)-activated kinase 2
sheep(101123517) p21 protein (Cdc42/Rac)-activated kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300434 Anti-PAK1/PAK2/PAK3 (Ab-423/402/421) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry pricing
PRS3887 Anti-PAK2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502068 Anti-PAK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4502069 Anti-PAK2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4502070 Anti-PAK2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4502071 Anti-PAK2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503964 Anti-phospho-PAK1/2/3 (pSer144/141/139) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503963 Anti-phospho-PAK1/2/3 (pThr423/402/421) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4300135 Anti-phospho-PAK1/PAK2/PAK3 (pThr423/pThr402/pThr421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry pricing
SAB4504634 Anti-phospho-PAK2 (pSer141) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504633 Anti-phospho-PAK2 (pSer192) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB5700470 Anti-Phospho-PAK2-S20 antibody produced in rabbit New mouse, human
western blot pricing
WH0005062M1 Monoclonal Anti-PAK2 antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002577 siRNAs that have been validated in the lab human pricing
NM_053306 Rosetta Predictions rat pricing
NM_177326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002577 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014672 validated 509
1 SASI_Hs01_00014671 validated 1553
1 SASI_Hs01_00014673 validated 1399
2 SASI_Hs01_00014674 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045130 predicted 957
2 SASI_Rn01_00045131 predicted 990
3 SASI_Rn01_00045132 predicted 980
4 SASI_Rn01_00045133 predicted 1255
5 SASI_Rn01_00045134 predicted 942
6 SASI_Rn01_00045135 predicted 1544
7 SASI_Rn01_00045137 predicted 950
8 SASI_Rn01_00045138 predicted 1476
9 SASI_Rn02_00265716 predicted 548
10 SASI_Rn01_00045139 predicted 1031
11 SASI_Rn01_00045136 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187392 predicted 1198
2 SASI_Mm01_00187393 predicted 1068
3 SASI_Mm01_00187394 predicted 1054
4 SASI_Mm01_00187395 predicted 1553
5 SASI_Mm01_00187396 predicted 1152
6 SASI_Mm01_00187397 predicted 1020
7 SASI_Mm01_00187398 predicted 1622
8 SASI_Mm01_00187399 predicted 1328
9 SASI_Mm02_00347422 predicted 1257
10 SASI_Mm01_00187400 predicted 1514
11 SASI_Mm01_00187401 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177326
VALIDATED
PAK2 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-254s21c1
Sequence:CCGGTTCGGATGAGCAGTACCATTTCTCGAGAAATGGTACTGCTCATCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1246s21c1
Sequence:CCGGGCCGTGTGCAGAGAGTGTTTACTCGAGTAAACACTCTCTGCACACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-1938s21c1
Sequence:CCGGAGTAAGAGAGCTATGACTTTGCTCGAGCAAAGTCATAGCTCTCTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-2251s21c1
Sequence:CCGGATGATTGATGTAGCTCTTTACCTCGAGGTAAAGAGCTACATCAATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1030s21c1
Sequence:CCGGGTTGCTATCAAGCAGATTAATCTCGAGATTAATCTGCTTGATAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-686s1c1
Sequence:CCGGCGATGAAGAGATTATGGAGAACTCGAGTTCTCCATAATCTCTTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-1412s1c1
Sequence:CCGGCCCAATATTTCGGGATTTCTTCTCGAGAAGAAATCCCGAAATATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177326.1-100s1c1
Sequence:CCGGCCAATCACAGTTTGAAACCTTCTCGAGAAGGTTTCAAACTGTGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-900s1c1
Sequence:CCGGGAGTTAAAGAATCCCAACATACTCGAGTATGTTGGGATTCTTTAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177326
VALIDATED
PAK2 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-254s21c1
Sequence:CCGGTTCGGATGAGCAGTACCATTTCTCGAGAAATGGTACTGCTCATCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1246s21c1
Sequence:CCGGGCCGTGTGCAGAGAGTGTTTACTCGAGTAAACACTCTCTGCACACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-1938s21c1
Sequence:CCGGAGTAAGAGAGCTATGACTTTGCTCGAGCAAAGTCATAGCTCTCTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-2251s21c1
Sequence:CCGGATGATTGATGTAGCTCTTTACCTCGAGGTAAAGAGCTACATCAATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1030s21c1
Sequence:CCGGGTTGCTATCAAGCAGATTAATCTCGAGATTAATCTGCTTGATAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-686s1c1
Sequence:CCGGCGATGAAGAGATTATGGAGAACTCGAGTTCTCCATAATCTCTTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-1412s1c1
Sequence:CCGGCCCAATATTTCGGGATTTCTTCTCGAGAAGAAATCCCGAAATATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177326.1-100s1c1
Sequence:CCGGCCAATCACAGTTTGAAACCTTCTCGAGAAGGTTTCAAACTGTGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-900s1c1
Sequence:CCGGGAGTTAAAGAATCCCAACATACTCGAGTATGTTGGGATTCTTTAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177326
VALIDATED
PAK2 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-254s21c1
Sequence:CCGGTTCGGATGAGCAGTACCATTTCTCGAGAAATGGTACTGCTCATCCGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1246s21c1
Sequence:CCGGGCCGTGTGCAGAGAGTGTTTACTCGAGTAAACACTCTCTGCACACGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-1938s21c1
Sequence:CCGGAGTAAGAGAGCTATGACTTTGCTCGAGCAAAGTCATAGCTCTCTTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177326.2-2251s21c1
Sequence:CCGGATGATTGATGTAGCTCTTTACCTCGAGGTAAAGAGCTACATCAATCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177326.2-1030s21c1
Sequence:CCGGGTTGCTATCAAGCAGATTAATCTCGAGATTAATCTGCTTGATAGCAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-686s1c1
Sequence:CCGGCGATGAAGAGATTATGGAGAACTCGAGTTCTCCATAATCTCTTCATCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-1412s1c1
Sequence:CCGGCCCAATATTTCGGGATTTCTTCTCGAGAAGAAATCCCGAAATATTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177326.1-100s1c1
Sequence:CCGGCCAATCACAGTTTGAAACCTTCTCGAGAAGGTTTCAAACTGTGATTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177326.1-900s1c1
Sequence:CCGGGAGTTAAAGAATCCCAACATACTCGAGTATGTTGGGATTCTTTAACTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002577
VALIDATED
PAK2 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-1555s1c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002577.3-4034s1c1
Sequence:CCGGGTGGATAAACTAACCTCTAACCTCGAGGTTAGAGGTTAGTTTATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-383s1c1
Sequence:CCGGCCATCCATGTTGGCTTTGATGCTCGAGCATCAAAGCCAACATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-950s1c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002577.4-2718s21c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1137s21c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1449s21c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002577.x-1416s1c1
Sequence:CCGGGTCTCTGGGTATCATGGCTATCTCGAGATAGCCATGATACCCAGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-1262s1c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-454s1c1
Sequence:CCGGCAGACCTCCAATATCACCAAACTCGAGTTTGGTGATATTGGAGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002114    
Product Details

Region:
TRC Version: 1 Clone ID:NM_002577.x-198s1c1
Sequence:CCGGCATCTTTAGCACTGGAGGCAACTCGAGTTGCCTCCAGTGCTAAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002115    
Product Details
Validated
Region: Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-2531s1c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1742s21c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002577
VALIDATED
PAK2 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-1555s1c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002577.3-4034s1c1
Sequence:CCGGGTGGATAAACTAACCTCTAACCTCGAGGTTAGAGGTTAGTTTATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-383s1c1
Sequence:CCGGCCATCCATGTTGGCTTTGATGCTCGAGCATCAAAGCCAACATGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-950s1c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002577.4-2718s21c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1137s21c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1449s21c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002577.x-1416s1c1
Sequence:CCGGGTCTCTGGGTATCATGGCTATCTCGAGATAGCCATGATACCCAGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-1262s1c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-454s1c1
Sequence:CCGGCAGACCTCCAATATCACCAAACTCGAGTTTGGTGATATTGGAGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002114    
Product Details

Region:
TRC Version: 1 Clone ID:NM_002577.x-198s1c1
Sequence:CCGGCATCTTTAGCACTGGAGGCAACTCGAGTTGCCTCCAGTGCTAAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002115    
Product Details
Validated
Region: Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-2531s1c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1742s21c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002577
VALIDATED
PAK2 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-1555s1c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002577.3-4034s1c1
Sequence:CCGGGTGGATAAACTAACCTCTAACCTCGAGGTTAGAGGTTAGTTTATCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-383s1c1
Sequence:CCGGCCATCCATGTTGGCTTTGATGCTCGAGCATCAAAGCCAACATGGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.3-950s1c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002577.4-2718s21c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1137s21c1
Sequence:CCGGGACAGGAGGTTGCTATCAAACCTCGAGGTTTGATAGCAACCTCCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1449s21c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002577.x-1416s1c1
Sequence:CCGGGTCTCTGGGTATCATGGCTATCTCGAGATAGCCATGATACCCAGAGACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-1262s1c1
Sequence:CCGGTGGGAATGGAAGGATCTGTTACTCGAGTAACAGATCCTTCCATTCCCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-454s1c1
Sequence:CCGGCAGACCTCCAATATCACCAAACTCGAGTTTGGTGATATTGGAGGTCTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002114    
Product Details

Region:
TRC Version: 1 Clone ID:NM_002577.x-198s1c1
Sequence:CCGGCATCTTTAGCACTGGAGGCAACTCGAGTTGCCTCCAGTGCTAAAGATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002115    
Product Details
Validated
Region: Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002577.x-2531s1c1
Sequence:CCGGCTCTAGGAACCAAAGTGATTTCTCGAGAAATCACTTTGGTTCCTAGAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002577.4-1742s21c1
Sequence:CCGGCGGGATTTCTTAAATCGATGTCTCGAGACATCGATTTAAGAAATCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???