EMAIL THIS PAGE TO A FRIEND

PAK3

p21 protein (Cdc42/Rac)-activated kinase 3

199 Gene Product Result for
Synonyms: CDKN1A MRX30 MRX47 OPHN3 PAK3beta bPAK hPAK3
Gene ID:
Human(5063) Summary: PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. PAK proteins, a family of serine/threonine p21-activating kinases, serve as targets for the small GTP binding proteins Cdc42 and RAC and have been implicated in a wide range of biological activities. The protein encoded by this gene forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1 proteins which then catalyzes a variety of targets. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(18481) p21 protein (Cdc42/Rac)-activated kinase 3
Rat(29433) p21 protein (Cdc42/Rac)-activated kinase 3
fruit fly(41995) CG14895 gene product from transcript CG14895-RD
chicken(422342) p21 protein (Cdc42/Rac)-activated kinase 3
cow(534526) p21 protein (Cdc42/Rac)-activated kinase 3
Horse(100054315) p21 protein (Cdc42/Rac)-activated kinase 3
domestic cat(101092248) p21 protein (Cdc42/Rac)-activated kinase 3
dog(492067) p21 protein (Cdc42/Rac)-activated kinase 3
sheep(101110391) p21 protein (Cdc42/Rac)-activated kinase 3
Domestic Rabbit(100347273) p21 protein (Cdc42/Rac)-activated kinase 3
naked mole-rat(101712811) p21 protein (Cdc42/Rac)-activated kinase 3
domestic guinea pig(100721049) p21 protein (Cdc42/Rac)-activated kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304714 ANTI-MOUSE PAK3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4300434 Anti-PAK1/PAK2/PAK3 (Ab-423/402/421) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry pricing
HPA060219 Anti-PAK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
P2979 Anti-PAK3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous glycerol solution rat, mouse
immunoprecipitation (IP), western blot pricing
SAB4502072 Anti-PAK3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503964 Anti-phospho-PAK1/2/3 (pSer144/141/139) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503963 Anti-phospho-PAK1/2/3 (pThr423/402/421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4300135 Anti-phospho-PAK1/PAK2/PAK3 (pThr423/pThr402/pThr421) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry pricing
SAB4504635 Anti-phospho-PAK3 (pSer154) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0005063M8 Monoclonal Anti-PAK3 antibody produced in mouse clone 3A12, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1404164 Monoclonal Anti-PAK3, (N-terminal) antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086841 MISSION® esiRNA esiRNA human PAK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128166 Rosetta Predictions human pricing
NM_001128167 Rosetta Predictions human pricing
NM_001128168 Rosetta Predictions human pricing
NM_001128172 Rosetta Predictions human pricing
NM_001128173 Rosetta Predictions human pricing
NM_002578 Rosetta Predictions human pricing
NM_019210 Rosetta Predictions rat pricing
NM_008778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330666 predicted 1507
2 SASI_Hs02_00330667 predicted 1636
3 SASI_Hs02_00330668 predicted 2031
4 SASI_Hs02_00330669 predicted 1279
5 SASI_Hs02_00330670 predicted 1764
6 SASI_Hs02_00330671 predicted 1524
7 SASI_Hs02_00330672 predicted 2034
8 SASI_Hs02_00330673 predicted 1778
9 SASI_Hs02_00330674 predicted 1310
10 SASI_Hs02_00330675 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330676 predicted 1439
2 SASI_Hs02_00330677 predicted 1567
3 SASI_Hs02_00330678 predicted 1953
4 SASI_Hs02_00330679 predicted 1204
5 SASI_Hs02_00330680 predicted 1700
6 SASI_Hs02_00330681 predicted 1452
7 SASI_Hs02_00330682 predicted 1963
8 SASI_Hs02_00330683 predicted 1705
9 SASI_Hs02_00330684 predicted 1236
10 SASI_Hs02_00330685 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330686 predicted 1199
2 SASI_Hs02_00330687 predicted 1328
3 SASI_Hs02_00330688 predicted 1720
4 SASI_Hs02_00330689 predicted 971
5 SASI_Hs02_00330690 predicted 1464
6 SASI_Hs02_00330691 predicted 1220
7 SASI_Hs02_00330692 predicted 1725
8 SASI_Hs02_00330693 predicted 1465
9 SASI_Hs02_00330694 predicted 1004
10 SASI_Hs02_00330695 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330696 predicted 1155
2 SASI_Hs02_00330697 predicted 1286
3 SASI_Hs02_00330698 predicted 1678
4 SASI_Hs02_00330699 predicted 929
5 SASI_Hs02_00330700 predicted 1414
6 SASI_Hs02_00330701 predicted 1175
7 SASI_Hs02_00330702 predicted 1676
8 SASI_Hs02_00330703 predicted 1425
9 SASI_Hs02_00330704 predicted 957
10 SASI_Hs02_00330705 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330706 predicted 1141
2 SASI_Hs02_00330707 predicted 1266
3 SASI_Hs02_00330708 predicted 1653
4 SASI_Hs02_00330709 predicted 907
5 SASI_Hs02_00330710 predicted 1397
6 SASI_Hs02_00330711 predicted 1150
7 SASI_Hs02_00330712 predicted 1660
8 SASI_Hs02_00330713 predicted 1407
9 SASI_Hs02_00330714 predicted 935
10 SASI_Hs02_00330715 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210080 predicted 1458
2 SASI_Hs01_00210081 predicted 1589
3 SASI_Hs02_00334076 predicted 1983
4 SASI_Hs01_00210082 predicted 1234
5 SASI_Hs01_00210083 predicted 1717
6 SASI_Hs01_00210084 predicted 1475
7 SASI_Hs01_00210085 predicted 1984
8 SASI_Hs01_00210086 predicted 1729
9 SASI_Hs01_00210087 predicted 1262
10 SASI_Hs01_00210089 predicted 1284
11 SASI_Hs01_00210088 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113791 predicted 1256
2 SASI_Rn01_00113792 predicted 1399
3 SASI_Rn01_00113793 predicted 1282
4 SASI_Rn01_00113794 predicted 950
5 SASI_Rn01_00113795 predicted 1463
6 SASI_Rn01_00113796 predicted 1213
7 SASI_Rn01_00113797 predicted 1685
8 SASI_Rn01_00113798 predicted 1058
9 SASI_Rn01_00113799 predicted 898
10 SASI_Rn01_00113800 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160902 predicted 1367
2 SASI_Mm01_00160903 predicted 921
3 SASI_Mm01_00160906 predicted 1431
4 SASI_Mm02_00314671 predicted 1622
5 SASI_Mm01_00160907 predicted 1026
6 SASI_Mm02_00314672 predicted 1493
7 SASI_Mm01_00160908 predicted 258
8 SASI_Mm02_00314673 predicted 1611
9 SASI_Mm01_00160909 predicted 1249
10 SASI_Mm02_00314674 predicted 1690
11 SASI_Mm01_00160904 predicted 1312
12 SASI_Mm01_00160905 predicted 695
13 SASI_Mm01_00160910 predicted 1640
14 SASI_Mm01_00160911 predicted 1812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002578
PAK3 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-691s1c1
Sequence:CCGGGCACGATTACTCCAAACTTCCCTCGAGGGAAGTTTGGAGTAATCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1860s1c1
Sequence:CCGGGTCAGCTGTATTCCGTGACTTCTCGAGAAGTCACGGAATACAGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1738s1c1
Sequence:CCGGCTTGGAATTATGGCAATTGAACTCGAGTTCAATTGCCATAATTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-331s1c1
Sequence:CCGGGAACAGAAGAAGAACCCACAACTCGAGTTGTGGGTTCTTCTTCTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-306s1c1
Sequence:CCGGCCAAACTTCCAACATAACAAACTCGAGTTTGTTATGTTGGAAGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-910s1c1
Sequence:CCGGCAACCCAAGAAGGAATTAATTCTCGAGAATTAATTCCTTCTTGGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-763s1c1
Sequence:CCGGCTAAGAAGCATTGTGAGTGTTCTCGAGAACACTCACAATGCTTCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002578
PAK3 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-691s1c1
Sequence:CCGGGCACGATTACTCCAAACTTCCCTCGAGGGAAGTTTGGAGTAATCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1860s1c1
Sequence:CCGGGTCAGCTGTATTCCGTGACTTCTCGAGAAGTCACGGAATACAGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1738s1c1
Sequence:CCGGCTTGGAATTATGGCAATTGAACTCGAGTTCAATTGCCATAATTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-331s1c1
Sequence:CCGGGAACAGAAGAAGAACCCACAACTCGAGTTGTGGGTTCTTCTTCTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-306s1c1
Sequence:CCGGCCAAACTTCCAACATAACAAACTCGAGTTTGTTATGTTGGAAGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-910s1c1
Sequence:CCGGCAACCCAAGAAGGAATTAATTCTCGAGAATTAATTCCTTCTTGGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-763s1c1
Sequence:CCGGCTAAGAAGCATTGTGAGTGTTCTCGAGAACACTCACAATGCTTCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002578
PAK3 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-691s1c1
Sequence:CCGGGCACGATTACTCCAAACTTCCCTCGAGGGAAGTTTGGAGTAATCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1860s1c1
Sequence:CCGGGTCAGCTGTATTCCGTGACTTCTCGAGAAGTCACGGAATACAGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002578.2-1738s1c1
Sequence:CCGGCTTGGAATTATGGCAATTGAACTCGAGTTCAATTGCCATAATTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-331s1c1
Sequence:CCGGGAACAGAAGAAGAACCCACAACTCGAGTTGTGGGTTCTTCTTCTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-306s1c1
Sequence:CCGGCCAAACTTCCAACATAACAAACTCGAGTTTGTTATGTTGGAAGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-910s1c1
Sequence:CCGGCAACCCAAGAAGGAATTAATTCTCGAGAATTAATTCCTTCTTGGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002578.x-763s1c1
Sequence:CCGGCTAAGAAGCATTGTGAGTGTTCTCGAGAACACTCACAATGCTTCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008778
VALIDATED
PAK3 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1638s1c1
Sequence:CCGGCCTGGATTTCTTGCACTCAAACTCGAGTTTGAGTGCAAGAAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-1761s1c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1984s1c1
Sequence:CCGGGCTGTATTCCATGACTTCTTACTCGAGTAAGAAGTCATGGAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-908s1c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1272s21c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-419s21c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1867s21c1
Sequence:CCGGGCAATGTCGAAGTAGCCATTACTCGAGTAATGGCTACTTCGACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008778.2-329s21c1
Sequence:CCGGTACTCCAAACCTCCAACATAACTCGAGTTATGTTGGAGGTTTGGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1626s21c1
Sequence:CCGGCGCCGCAAAGGAAGCAATTAACTCGAGTTAATTGCTTCCTTTGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008778
VALIDATED
PAK3 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1638s1c1
Sequence:CCGGCCTGGATTTCTTGCACTCAAACTCGAGTTTGAGTGCAAGAAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-1761s1c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1984s1c1
Sequence:CCGGGCTGTATTCCATGACTTCTTACTCGAGTAAGAAGTCATGGAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-908s1c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1272s21c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-419s21c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1867s21c1
Sequence:CCGGGCAATGTCGAAGTAGCCATTACTCGAGTAATGGCTACTTCGACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008778.2-329s21c1
Sequence:CCGGTACTCCAAACCTCCAACATAACTCGAGTTATGTTGGAGGTTTGGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1626s21c1
Sequence:CCGGCGCCGCAAAGGAAGCAATTAACTCGAGTTAATTGCTTCCTTTGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008778
VALIDATED
PAK3 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1638s1c1
Sequence:CCGGCCTGGATTTCTTGCACTCAAACTCGAGTTTGAGTGCAAGAAATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-1761s1c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008778.1-1984s1c1
Sequence:CCGGGCTGTATTCCATGACTTCTTACTCGAGTAAGAAGTCATGGAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008778.1-908s1c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1272s21c1
Sequence:CCGGGCAAAGTAAACGAAGCACTATCTCGAGATAGTGCTTCGTTTACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-419s21c1
Sequence:CCGGCGGTCAACAACCAGAAATATACTCGAGTATATTTCTGGTTGTTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1867s21c1
Sequence:CCGGGCAATGTCGAAGTAGCCATTACTCGAGTAATGGCTACTTCGACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008778.2-329s21c1
Sequence:CCGGTACTCCAAACCTCCAACATAACTCGAGTTATGTTGGAGGTTTGGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008778.2-1626s21c1
Sequence:CCGGCGCCGCAAAGGAAGCAATTAACTCGAGTTAATTGCTTCCTTTGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)