EMAIL THIS PAGE TO A FRIEND

PAK6

p21 protein (Cdc42/Rac)-activated kinase 6

82 Gene Product Result for
Synonyms: PAK5
UniProtKB ID: Q9NQU5, A8K2G2
Gene ID:
Human(56924) Summary: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(214230) p21 protein (Cdc42/Rac)-activated kinase 6
Rat(296078) p21 protein (Cdc42/Rac)-activated kinase 6
chicken(428837) p21 protein (Cdc42/Rac)-activated kinase 6
dog(487490) p21 protein (Cdc42/Rac)-activated kinase 6
domestic cat(101091201) p21 protein (Cdc42/Rac)-activated kinase 6
cow(539224) p21 protein (Cdc42/Rac)-activated kinase 6
Horse(100071463) p21 protein (Cdc42/Rac)-activated kinase 6
Goat(100860973) p21 protein (Cdc42/Rac)-activated kinase 6
sheep(101112573) p21 protein (Cdc42/Rac)-activated kinase 6
Domestic Rabbit(100348921) p21 protein (Cdc42/Rac)-activated kinase 6
naked mole-rat(101706200) p21 protein (Cdc42/Rac)-activated kinase 6
domestic guinea pig(100713585) p21 protein (Cdc42/Rac)-activated kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_111790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_111790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_111790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129261 MISSION® esiRNA esiRNA human PAK6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020168 Rosetta Predictions human pricing
NM_001106498 Rosetta Predictions rat pricing
NM_001033254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137121 predicted 1377
2 SASI_Hs01_00137122 predicted 1556
3 SASI_Hs01_00137123 predicted 2032
4 SASI_Hs01_00137124 predicted 2305
5 SASI_Hs02_00353076 predicted 1561
6 SASI_Hs02_00353077 predicted 1242
7 SASI_Hs01_00137126 predicted 1576
8 SASI_Hs01_00137127 predicted 2826
9 SASI_Hs01_00137128 predicted 1180
10 SASI_Hs01_00137129 predicted 2422
11 SASI_Hs01_00137125 predicted 692
12 SASI_Hs01_00137130 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219558 predicted 2104
2 SASI_Rn02_00219559 predicted 1524
3 SASI_Rn02_00219560 predicted 1934
4 SASI_Rn02_00219561 predicted 2299
5 SASI_Rn02_00219562 predicted 2389
6 SASI_Rn02_00219563 predicted 1791
7 SASI_Rn02_00219564 predicted 2004
8 SASI_Rn02_00219565 predicted 2406
9 SASI_Rn02_00219566 predicted 761
10 SASI_Rn02_00219567 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182741 predicted 2063
2 SASI_Mm01_00182742 predicted 2809
3 SASI_Mm01_00182743 predicted 1806
4 SASI_Mm01_00182744 predicted 2216
5 SASI_Mm01_00182745 predicted 2080
6 SASI_Mm01_00182746 predicted 2740
7 SASI_Mm01_00182747 predicted 2786
8 SASI_Mm01_00182748 predicted 2586
9 SASI_Mm01_00182749 predicted 1045
10 SASI_Mm01_00182750 predicted 2284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020168
PAK6 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-2214s1c1
Sequence:CCGGGCCACCGTACTTCAGTGACTCCTCGAGGAGTCACTGAAGTACGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3337s1c1
Sequence:CCGGCCATGCTAAGTCTAACACTCCCTCGAGGGAGTGTTAGACTTAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-502s1c1
Sequence:CCGGCCCAAAGAAGGCAAGTTTGTGCTCGAGCACAAACTTGCCTTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3438s1c1
Sequence:CCGGGTGTTACCTTTCAAGTTTATCCTCGAGGATAAACTTGAAAGGTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3684s1c1
Sequence:CCGGGACCCTTTCTATCTAGATAATCTCGAGATTATCTAGATAGAAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-1052s1c1
Sequence:CCGGGCACCAATAGGCATGGAATGACTCGAGTCATTCCATGCCTATTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3092s1c1
Sequence:CCGGGCTCTCACTTTACAGAATGGACTCGAGTCCATTCTGTAAAGTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.3-2043s1c1
Sequence:CCGGGCTCTCGGACTTCGGATTCTGCTCGAGCAGAATCCGAAGTCCGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-684s1c1
Sequence:CCGGCATCCAGAAGTTGTCAGTCATCTCGAGATGACTGACAACTTCTGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2069s1c1
Sequence:CCGGAGATCAGCAAAGACGTCCCTACTCGAGTAGGGACGTCTTTGCTGATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-1896s1c1
Sequence:CCGGCGTCTCCCAAGTCAGGCTGAACTCGAGTTCAGCCTGACTTGGGAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2133s1c1
Sequence:CCGGAGTGATCTCCAGGTCTTTGTACTCGAGTACAAAGACCTGGAGATCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.x-2708s1c1
Sequence:CCGGGCACAGGGATATTTCTAAGAACTCGAGTTCTTAGAAATATCCCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020168
PAK6 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-2214s1c1
Sequence:CCGGGCCACCGTACTTCAGTGACTCCTCGAGGAGTCACTGAAGTACGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3337s1c1
Sequence:CCGGCCATGCTAAGTCTAACACTCCCTCGAGGGAGTGTTAGACTTAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-502s1c1
Sequence:CCGGCCCAAAGAAGGCAAGTTTGTGCTCGAGCACAAACTTGCCTTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3438s1c1
Sequence:CCGGGTGTTACCTTTCAAGTTTATCCTCGAGGATAAACTTGAAAGGTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3684s1c1
Sequence:CCGGGACCCTTTCTATCTAGATAATCTCGAGATTATCTAGATAGAAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-1052s1c1
Sequence:CCGGGCACCAATAGGCATGGAATGACTCGAGTCATTCCATGCCTATTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3092s1c1
Sequence:CCGGGCTCTCACTTTACAGAATGGACTCGAGTCCATTCTGTAAAGTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.3-2043s1c1
Sequence:CCGGGCTCTCGGACTTCGGATTCTGCTCGAGCAGAATCCGAAGTCCGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-684s1c1
Sequence:CCGGCATCCAGAAGTTGTCAGTCATCTCGAGATGACTGACAACTTCTGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2069s1c1
Sequence:CCGGAGATCAGCAAAGACGTCCCTACTCGAGTAGGGACGTCTTTGCTGATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-1896s1c1
Sequence:CCGGCGTCTCCCAAGTCAGGCTGAACTCGAGTTCAGCCTGACTTGGGAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2133s1c1
Sequence:CCGGAGTGATCTCCAGGTCTTTGTACTCGAGTACAAAGACCTGGAGATCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.x-2708s1c1
Sequence:CCGGGCACAGGGATATTTCTAAGAACTCGAGTTCTTAGAAATATCCCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020168
PAK6 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-2214s1c1
Sequence:CCGGGCCACCGTACTTCAGTGACTCCTCGAGGAGTCACTGAAGTACGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3337s1c1
Sequence:CCGGCCATGCTAAGTCTAACACTCCCTCGAGGGAGTGTTAGACTTAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-502s1c1
Sequence:CCGGCCCAAAGAAGGCAAGTTTGTGCTCGAGCACAAACTTGCCTTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3438s1c1
Sequence:CCGGGTGTTACCTTTCAAGTTTATCCTCGAGGATAAACTTGAAAGGTAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3684s1c1
Sequence:CCGGGACCCTTTCTATCTAGATAATCTCGAGATTATCTAGATAGAAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020168.3-1052s1c1
Sequence:CCGGGCACCAATAGGCATGGAATGACTCGAGTCATTCCATGCCTATTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.3-3092s1c1
Sequence:CCGGGCTCTCACTTTACAGAATGGACTCGAGTCCATTCTGTAAAGTGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.3-2043s1c1
Sequence:CCGGGCTCTCGGACTTCGGATTCTGCTCGAGCAGAATCCGAAGTCCGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-684s1c1
Sequence:CCGGCATCCAGAAGTTGTCAGTCATCTCGAGATGACTGACAACTTCTGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2069s1c1
Sequence:CCGGAGATCAGCAAAGACGTCCCTACTCGAGTAGGGACGTCTTTGCTGATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-1896s1c1
Sequence:CCGGCGTCTCCCAAGTCAGGCTGAACTCGAGTTCAGCCTGACTTGGGAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020168.x-2133s1c1
Sequence:CCGGAGTGATCTCCAGGTCTTTGTACTCGAGTACAAAGACCTGGAGATCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020168.x-2708s1c1
Sequence:CCGGGCACAGGGATATTTCTAAGAACTCGAGTTCTTAGAAATATCCCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_111790
VALIDATED
PAK6 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1406s1c1
Sequence:CCGGCTGGACAGCTACGTGAAGATTCTCGAGAATCTTCACGTAGCTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-439s1c1
Sequence:CCGGGCTCAACGACATTCAGAAGTTCTCGAGAACTTCTGAATGTCGTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1652s1c1
Sequence:CCGGCTCACAGACATCATCTCCCAACTCGAGTTGGGAGATGATGTCTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-299s1c1
Sequence:CCGGCAATGGCAGAACATTCTGGATCTCGAGATCCAGAATGTTCTGCCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-926s1c1
Sequence:CCGGCCTAGCCCTAAGAACCAGGAACTCGAGTTCCTGGTTCTTAGGGCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_111790
VALIDATED
PAK6 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1406s1c1
Sequence:CCGGCTGGACAGCTACGTGAAGATTCTCGAGAATCTTCACGTAGCTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-439s1c1
Sequence:CCGGGCTCAACGACATTCAGAAGTTCTCGAGAACTTCTGAATGTCGTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1652s1c1
Sequence:CCGGCTCACAGACATCATCTCCCAACTCGAGTTGGGAGATGATGTCTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-299s1c1
Sequence:CCGGCAATGGCAGAACATTCTGGATCTCGAGATCCAGAATGTTCTGCCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-926s1c1
Sequence:CCGGCCTAGCCCTAAGAACCAGGAACTCGAGTTCCTGGTTCTTAGGGCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_111790
VALIDATED
PAK6 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1406s1c1
Sequence:CCGGCTGGACAGCTACGTGAAGATTCTCGAGAATCTTCACGTAGCTGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-439s1c1
Sequence:CCGGGCTCAACGACATTCAGAAGTTCTCGAGAACTTCTGAATGTCGTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-1652s1c1
Sequence:CCGGCTCACAGACATCATCTCCCAACTCGAGTTGGGAGATGATGTCTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_111790.4-299s1c1
Sequence:CCGGCAATGGCAGAACATTCTGGATCTCGAGATCCAGAATGTTCTGCCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_111790.4-926s1c1
Sequence:CCGGCCTAGCCCTAAGAACCAGGAACTCGAGTTCCTGGTTCTTAGGGCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145854
VALIDATED
PAK6 MISSION shRNA Bacterial Glycerol Stock
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1742s21c1
Sequence:CCGGCCGAGATATCAAGAGTGATTCCTCGAGGAATCACTCTTGATATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1901s21c1
Sequence:CCGGGTACGCTACTGAGGTGGATATCTCGAGATATCCACCTCAGTAGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-2025s21c1
Sequence:CCGGCCCAAGCTAAAGAACTCTTACCTCGAGGTAAGAGTTCTTTAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-1502s21c1
Sequence:CCGGACGCAGGGAGCTGCTCTTTAACTCGAGTTAAAGAGCAGCTCCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145854
VALIDATED
PAK6 MISSION shRNA shRNA Plasmid DNA
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1742s21c1
Sequence:CCGGCCGAGATATCAAGAGTGATTCCTCGAGGAATCACTCTTGATATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1901s21c1
Sequence:CCGGGTACGCTACTGAGGTGGATATCTCGAGATATCCACCTCAGTAGCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-2025s21c1
Sequence:CCGGCCCAAGCTAAAGAACTCTTACCTCGAGGTAAGAGTTCTTTAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-1502s21c1
Sequence:CCGGACGCAGGGAGCTGCTCTTTAACTCGAGTTAAAGAGCAGCTCCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145854
VALIDATED
PAK6 MISSION shRNA Lentiviral Transduction Particles
p21 protein (Cdc42/Rac)-activated kinase 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1742s21c1
Sequence:CCGGCCGAGATATCAAGAGTGATTCCTCGAGGAATCACTCTTGATATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001145854.1-1901s21c1
Sequence:CCGGGTACGCTACTGAGGTGGATATCTCGAGATATCCACCTCAGTAGCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-2025s21c1
Sequence:CCGGCCCAAGCTAAAGAACTCTTACCTCGAGGTAAGAGTTCTTTAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145854.1-1502s21c1
Sequence:CCGGACGCAGGGAGCTGCTCTTTAACTCGAGTTAAAGAGCAGCTCCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)