EMAIL THIS PAGE TO A FRIEND

PALB2

partner and localizer of BRCA2

111 Gene Product Result for
Synonyms: FANCN PNCA3
UniProtKB ID: Q86YC2, A6NIE1, Q8N7Y6, Q8ND31, Q9H6W1
Gene ID:
Human(79728) Summary: This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
Mouse(233826) partner and localizer of BRCA2
Rat(293452) partner and localizer of BRCA2
Zebrafish(558923) partner and localizer of BRCA2
domestic cat(101089732) partner and localizer of BRCA2
Horse(100069097) partner and localizer of BRCA2
cow(507620) partner and localizer of BRCA2
dog(608527) partner and localizer of BRCA2
chicken(416572) partner and localizer of BRCA2
sheep(101105207) partner and localizer of BRCA2
naked mole-rat(101720121) partner and localizer of BRCA2
Domestic Rabbit(100356031) partner and localizer of BRCA2
domestic guinea pig(100721467) partner and localizer of BRCA2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024675 Rosetta Predictions human pricing
XM_001076297 Rosetta Predictions rat pricing
XM_215047 Rosetta Predictions rat pricing
NM_001081238 Rosetta Predictions mouse pricing
XM_485999 Rosetta Predictions mouse pricing
XM_901624 Rosetta Predictions mouse pricing
XM_901629 Rosetta Predictions mouse pricing
XM_901633 Rosetta Predictions mouse pricing
XM_901636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229195 predicted 2052
2 SASI_Hs02_00357097 predicted 992
3 SASI_Hs01_00229196 predicted 1785
4 SASI_Hs01_00229198 predicted 762
5 SASI_Hs01_00229199 predicted 3019
6 SASI_Hs02_00357098 predicted 1100
7 SASI_Hs01_00229200 predicted 3620
8 SASI_Hs01_00229202 predicted 1011
9 SASI_Hs02_00357099 predicted 2756
10 SASI_Hs02_00357100 predicted 1901
11 SASI_Hs01_00229197 predicted 2160
12 SASI_Hs01_00229201 predicted 2777
13 SASI_Hs01_00229203 predicted 2129
14 SASI_Hs01_00229204 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352740 predicted 647
2 SASI_Rn02_00352741 predicted 550
3 SASI_Rn02_00352742 predicted 1439
4 SASI_Rn02_00352743 predicted 1944
5 SASI_Rn02_00352744 predicted 957
6 SASI_Rn02_00352745 predicted 1515
7 SASI_Rn02_00352746 predicted 208
8 SASI_Rn02_00352747 predicted 1416
9 SASI_Rn02_00352748 predicted 1460
10 SASI_Rn02_00352749 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375767 predicted 656
2 SASI_Rn02_00375768 predicted 552
3 SASI_Rn02_00375769 predicted 1448
4 SASI_Rn02_00375770 predicted 1950
5 SASI_Rn02_00375771 predicted 959
6 SASI_Rn02_00375772 predicted 1519
7 SASI_Rn02_00375773 predicted 209
8 SASI_Rn02_00375774 predicted 1413
9 SASI_Rn02_00375775 predicted 1460
10 SASI_Rn02_00375776 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296527 predicted 452
2 SASI_Mm02_00296528 predicted 2565
3 SASI_Mm02_00296529 predicted 468
4 SASI_Mm02_00296530 predicted 1742
5 SASI_Mm02_00296531 predicted 1178
6 SASI_Mm02_00296532 predicted 2900
7 SASI_Mm02_00296533 predicted 1041
8 SASI_Mm02_00296534 predicted 1195
9 SASI_Mm02_00296535 predicted 2654
10 SASI_Mm02_00296536 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224002 predicted 3235
2 SASI_Mm01_00224003 predicted 2673
3 SASI_Mm01_00224004 predicted 2674
4 SASI_Mm01_00224005 predicted 2709
5 SASI_Mm01_00224006 predicted 2686
6 SASI_Mm01_00224007 predicted 3230
7 SASI_Mm01_00224008 predicted 3176
8 SASI_Mm01_00224009 predicted 3190
9 SASI_Mm01_00224010 predicted 2686
10 SASI_Mm01_00224011 predicted 3175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230214 predicted 458
2 SASI_Mm01_00230215 predicted 476
3 SASI_Mm01_00230216 predicted 1836
4 SASI_Mm01_00230217 predicted 1866
5 SASI_Mm01_00230218 predicted 1727
6 SASI_Mm01_00230219 predicted 1182
7 SASI_Mm01_00230220 predicted 1044
8 SASI_Mm01_00230221 predicted 1199
9 SASI_Mm01_00230222 predicted 1223
10 SASI_Mm01_00230223 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241216 predicted 2421
2 SASI_Mm01_00241217 predicted 2516
3 SASI_Mm01_00241218 predicted 2454
4 SASI_Mm01_00241219 predicted 2081
5 SASI_Mm01_00241220 predicted 2472
6 SASI_Mm01_00241221 predicted 2508
7 SASI_Mm01_00241222 predicted 2483
8 SASI_Mm01_00241223 predicted 2004
9 SASI_Mm01_00241224 predicted 1909
10 SASI_Mm01_00241225 predicted 2256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232921 predicted 1038
2 SASI_Mm01_00232922 predicted 471
3 SASI_Mm01_00232923 predicted 485
4 SASI_Mm01_00232924 predicted 510
5 SASI_Mm01_00232925 predicted 480
6 SASI_Mm01_00232926 predicted 1031
7 SASI_Mm01_00232927 predicted 981
8 SASI_Mm01_00232928 predicted 993
9 SASI_Mm01_00232929 predicted 488
10 SASI_Mm01_00232930 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270956 predicted 458
2 SASI_Mm01_00270957 predicted 2578
3 SASI_Mm01_00270958 predicted 2607
4 SASI_Mm01_00270959 predicted 2225
5 SASI_Mm01_00270960 predicted 2618
6 SASI_Mm01_00270961 predicted 2661
7 SASI_Mm01_00270962 predicted 2405
8 SASI_Mm01_00270963 predicted 365
9 SASI_Mm01_00270964 predicted 2426
10 SASI_Mm01_00270965 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024675
VALIDATED
PALB2 MISSION shRNA Bacterial Glycerol Stock
partner and localizer of BRCA2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3865s1c1
Sequence:CCGGCCACTGATCTTGGATGTACATCTCGAGATGTACATCCAAGATCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024675.2-1884s1c1
Sequence:CCGGGCTTATTTATCCTTGGATGATCTCGAGATCATCCAAGGATAAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3293s1c1
Sequence:CCGGGATGCACATTGATGATTCTTACTCGAGTAAGAATCATCAATGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-3275s21c1
Sequence:CCGGTCTGCTTGGTACTACTATTATCTCGAGATAATAGTAGTACCAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-905s21c1
Sequence:CCGGATTCCTAAGAAGACCTAATTTCTCGAGAAATTAGGTCTTCTTAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2289s1c1
Sequence:CCGGGGCCTTTCTTCATCCATATTACTCGAGTAATATGGATGAAGAAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2208s1c1
Sequence:CCGGGACTTAGAAGAGGACCTTATTCTCGAGAATAAGGTCCTCTTCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024675.3-3795s21c1
Sequence:CCGGATATTGGGCCTCTTAGTATTTCTCGAGAAATACTAAGAGGCCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024675
VALIDATED
PALB2 MISSION shRNA shRNA Plasmid DNA
partner and localizer of BRCA2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3865s1c1
Sequence:CCGGCCACTGATCTTGGATGTACATCTCGAGATGTACATCCAAGATCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024675.2-1884s1c1
Sequence:CCGGGCTTATTTATCCTTGGATGATCTCGAGATCATCCAAGGATAAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3293s1c1
Sequence:CCGGGATGCACATTGATGATTCTTACTCGAGTAAGAATCATCAATGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-3275s21c1
Sequence:CCGGTCTGCTTGGTACTACTATTATCTCGAGATAATAGTAGTACCAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-905s21c1
Sequence:CCGGATTCCTAAGAAGACCTAATTTCTCGAGAAATTAGGTCTTCTTAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2289s1c1
Sequence:CCGGGGCCTTTCTTCATCCATATTACTCGAGTAATATGGATGAAGAAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2208s1c1
Sequence:CCGGGACTTAGAAGAGGACCTTATTCTCGAGAATAAGGTCCTCTTCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024675.3-3795s21c1
Sequence:CCGGATATTGGGCCTCTTAGTATTTCTCGAGAAATACTAAGAGGCCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024675
VALIDATED
PALB2 MISSION shRNA Lentiviral Transduction Particles
partner and localizer of BRCA2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3865s1c1
Sequence:CCGGCCACTGATCTTGGATGTACATCTCGAGATGTACATCCAAGATCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024675.2-1884s1c1
Sequence:CCGGGCTTATTTATCCTTGGATGATCTCGAGATCATCCAAGGATAAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.2-3293s1c1
Sequence:CCGGGATGCACATTGATGATTCTTACTCGAGTAAGAATCATCAATGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-3275s21c1
Sequence:CCGGTCTGCTTGGTACTACTATTATCTCGAGATAATAGTAGTACCAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024675.3-905s21c1
Sequence:CCGGATTCCTAAGAAGACCTAATTTCTCGAGAAATTAGGTCTTCTTAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2289s1c1
Sequence:CCGGGGCCTTTCTTCATCCATATTACTCGAGTAATATGGATGAAGAAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024675.3-2208s1c1
Sequence:CCGGGACTTAGAAGAGGACCTTATTCTCGAGAATAAGGTCCTCTTCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024675.3-3795s21c1
Sequence:CCGGATATTGGGCCTCTTAGTATTTCTCGAGAAATACTAAGAGGCCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081238
VALIDATED
PALB2 MISSION shRNA Bacterial Glycerol Stock
partner and localizer of BRCA2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1729s21c1
Sequence:CCGGGCAAATTCACCAAGCATAAATCTCGAGATTTATGCTTGGTGAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-807s21c1
Sequence:CCGGGGAATTGGAGAGGGTATATTACTCGAGTAATATACCCTCTCCAATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1045s21c1
Sequence:CCGGCAGTAAACTCAGTAGTATATACTCGAGTATATACTACTGAGTTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-2708s21c1
Sequence:CCGGGCCTGATGTTTACAATCTTATCTCGAGATAAGATTGTAAACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-3577s21c1
Sequence:CCGGGTGATTACTTGAATGTATTTCCTCGAGGAAATACATTCAAGTAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081238
VALIDATED
PALB2 MISSION shRNA shRNA Plasmid DNA
partner and localizer of BRCA2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1729s21c1
Sequence:CCGGGCAAATTCACCAAGCATAAATCTCGAGATTTATGCTTGGTGAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-807s21c1
Sequence:CCGGGGAATTGGAGAGGGTATATTACTCGAGTAATATACCCTCTCCAATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1045s21c1
Sequence:CCGGCAGTAAACTCAGTAGTATATACTCGAGTATATACTACTGAGTTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-2708s21c1
Sequence:CCGGGCCTGATGTTTACAATCTTATCTCGAGATAAGATTGTAAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-3577s21c1
Sequence:CCGGGTGATTACTTGAATGTATTTCCTCGAGGAAATACATTCAAGTAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081238
VALIDATED
PALB2 MISSION shRNA Lentiviral Transduction Particles
partner and localizer of BRCA2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1729s21c1
Sequence:CCGGGCAAATTCACCAAGCATAAATCTCGAGATTTATGCTTGGTGAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-807s21c1
Sequence:CCGGGGAATTGGAGAGGGTATATTACTCGAGTAATATACCCTCTCCAATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-1045s21c1
Sequence:CCGGCAGTAAACTCAGTAGTATATACTCGAGTATATACTACTGAGTTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081238.1-2708s21c1
Sequence:CCGGGCCTGATGTTTACAATCTTATCTCGAGATAAGATTGTAAACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081238.1-3577s21c1
Sequence:CCGGGTGATTACTTGAATGTATTTCCTCGAGGAAATACATTCAAGTAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)