EMAIL THIS PAGE TO A FRIEND

PALM3

paralemmin 3

66 Gene Product Result for
UniProtKB ID: A6NDB9
Gene ID:
Mouse(74337) paralemmin 3
Rat(100359592) paralemmin 3
Zebrafish(790940) paralemmin 3
cow(527118) paralemmin 3
dog(100688294) paralemmin 3
sheep(101118871) paralemmin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU179121 MISSION® esiRNA esiRNA targeting mouse Palm3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726585 Rosetta Predictions human pricing
XM_292820 Rosetta Predictions human pricing
XM_937298 Rosetta Predictions human pricing
NM_028877 Rosetta Predictions mouse pricing
XM_486140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00475174 predicted 1974
2 SASI_Hs02_00475175 predicted 1965
3 SASI_Hs02_00475176 predicted 338
4 SASI_Hs02_00475177 predicted 1998
5 SASI_Hs02_00475178 predicted 1999
6 SASI_Hs02_00475179 predicted 249
7 SASI_Hs02_00475180 predicted 400
8 SASI_Hs02_00475181 predicted 246
9 SASI_Hs02_00475182 predicted 1010
10 SASI_Hs02_00475183 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479105 predicted 1967
2 SASI_Hs02_00479106 predicted 1968
3 SASI_Hs01_00272989 predicted 346
4 SASI_Hs02_00479107 predicted 2001
5 SASI_Hs02_00479108 predicted 1992
6 SASI_Hs01_00272990 predicted 242
7 SASI_Hs01_00272991 predicted 401
8 SASI_Hs01_00272993 predicted 247
9 SASI_Hs01_00272994 predicted 1012
10 SASI_Hs01_00272995 predicted 679
11 SASI_Hs01_00272992 predicted 260
12 SASI_Hs01_00272996 predicted 500
13 SASI_Hs01_00272997 predicted 972
14 SASI_Hs01_00272998 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482539 predicted 1965
2 SASI_Hs02_00482540 predicted 1964
3 SASI_Hs02_00482541 predicted 339
4 SASI_Hs02_00482542 predicted 1998
5 SASI_Hs02_00482543 predicted 1996
6 SASI_Hs02_00482544 predicted 246
7 SASI_Hs02_00482545 predicted 401
8 SASI_Hs02_00482546 predicted 241
9 SASI_Hs02_00482547 predicted 1014
10 SASI_Hs02_00482548 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334553 predicted 2181
2 SASI_Mm02_00334554 predicted 460
3 SASI_Mm02_00334555 predicted 1878
4 SASI_Mm02_00334556 predicted 1006
5 SASI_Mm02_00334557 predicted 575
6 SASI_Mm02_00334558 predicted 1579
7 SASI_Mm02_00334559 predicted 714
8 SASI_Mm02_00334560 predicted 2194
9 SASI_Mm02_00334561 predicted 2193
10 SASI_Mm02_00334562 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260046 predicted 341
2 SASI_Mm01_00260047 predicted 312
3 SASI_Mm01_00260048 predicted 466
4 SASI_Mm01_00260049 predicted 574
5 SASI_Mm01_00260050 predicted 720
6 SASI_Mm01_00260051 predicted 341
7 SASI_Mm01_00260052 predicted 894
8 SASI_Mm01_00260053 predicted 673
9 SASI_Mm01_00260054 predicted 718
10 SASI_Mm01_00260055 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028877
PALM3 MISSION shRNA Bacterial Glycerol Stock
paralemmin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-955s21c1
Sequence:CCGGGGAGACTCCAGGAGCAATTTGCTCGAGCAAATTGCTCCTGGAGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1622s21c1
Sequence:CCGGGGATGGAGAGATAGGAGATAACTCGAGTTATCTCCTATCTCTCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-571s21c1
Sequence:CCGGGGCCATCCACTGAAGCTATAGCTCGAGCTATAGCTTCAGTGGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028877.1-2243s21c1
Sequence:CCGGCACTCCTCCTCTCACAGCTACCTCGAGGTAGCTGTGAGAGGAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1644s21c1
Sequence:CCGGAGCTCATTGGATGAAACTAAACTCGAGTTTAGTTTCATCCAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028877
PALM3 MISSION shRNA shRNA Plasmid DNA
paralemmin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-955s21c1
Sequence:CCGGGGAGACTCCAGGAGCAATTTGCTCGAGCAAATTGCTCCTGGAGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1622s21c1
Sequence:CCGGGGATGGAGAGATAGGAGATAACTCGAGTTATCTCCTATCTCTCCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-571s21c1
Sequence:CCGGGGCCATCCACTGAAGCTATAGCTCGAGCTATAGCTTCAGTGGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028877.1-2243s21c1
Sequence:CCGGCACTCCTCCTCTCACAGCTACCTCGAGGTAGCTGTGAGAGGAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1644s21c1
Sequence:CCGGAGCTCATTGGATGAAACTAAACTCGAGTTTAGTTTCATCCAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028877
PALM3 MISSION shRNA Lentiviral Transduction Particles
paralemmin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-955s21c1
Sequence:CCGGGGAGACTCCAGGAGCAATTTGCTCGAGCAAATTGCTCCTGGAGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1622s21c1
Sequence:CCGGGGATGGAGAGATAGGAGATAACTCGAGTTATCTCCTATCTCTCCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-571s21c1
Sequence:CCGGGGCCATCCACTGAAGCTATAGCTCGAGCTATAGCTTCAGTGGATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028877.1-2243s21c1
Sequence:CCGGCACTCCTCCTCTCACAGCTACCTCGAGGTAGCTGTGAGAGGAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028877.1-1644s21c1
Sequence:CCGGAGCTCATTGGATGAAACTAAACTCGAGTTTAGTTTCATCCAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145028
PALM3 MISSION shRNA Bacterial Glycerol Stock
paralemmin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1007s21c1
Sequence:CCGGGAGAGGAGGGATCCTTCATTTCTCGAGAAATGAAGGATCCCTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-135s21c1
Sequence:CCGGTCTCCGGGAACGTTGGCTAATCTCGAGATTAGCCAACGTTCCCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1629s21c1
Sequence:CCGGGTCTAGGGAAGGAAGTGAATCCTCGAGGATTCACTTCCTTCCCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-30s21c1
Sequence:CCGGGCTAGAAGTCATCGCTGAGAACTCGAGTTCTCAGCGATGACTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145028.1-2056s21c1
Sequence:CCGGTCACAGCTACCTCGGCCTCTTCTCGAGAAGAGGCCGAGGTAGCTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145028
PALM3 MISSION shRNA shRNA Plasmid DNA
paralemmin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1007s21c1
Sequence:CCGGGAGAGGAGGGATCCTTCATTTCTCGAGAAATGAAGGATCCCTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-135s21c1
Sequence:CCGGTCTCCGGGAACGTTGGCTAATCTCGAGATTAGCCAACGTTCCCGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1629s21c1
Sequence:CCGGGTCTAGGGAAGGAAGTGAATCCTCGAGGATTCACTTCCTTCCCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-30s21c1
Sequence:CCGGGCTAGAAGTCATCGCTGAGAACTCGAGTTCTCAGCGATGACTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145028.1-2056s21c1
Sequence:CCGGTCACAGCTACCTCGGCCTCTTCTCGAGAAGAGGCCGAGGTAGCTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145028
PALM3 MISSION shRNA Lentiviral Transduction Particles
paralemmin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1007s21c1
Sequence:CCGGGAGAGGAGGGATCCTTCATTTCTCGAGAAATGAAGGATCCCTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-135s21c1
Sequence:CCGGTCTCCGGGAACGTTGGCTAATCTCGAGATTAGCCAACGTTCCCGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-1629s21c1
Sequence:CCGGGTCTAGGGAAGGAAGTGAATCCTCGAGGATTCACTTCCTTCCCTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145028.1-30s21c1
Sequence:CCGGGCTAGAAGTCATCGCTGAGAACTCGAGTTCTCAGCGATGACTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145028.1-2056s21c1
Sequence:CCGGTCACAGCTACCTCGGCCTCTTCTCGAGAAGAGGCCGAGGTAGCTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)