EMAIL THIS PAGE TO A FRIEND

PALM

paralemmin

71 Gene Product Result for
Gene ID:
Human(5064) Summary: This gene encodes a member of the paralemmin protein family. The product of this gene is a prenylated and palmitoylated phosphoprotein that associates with the cytoplasmic face of plasma membranes and is implicated in plasma membrane dynamics in neurons and other cell types. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Mouse(18483) paralemmin
Rat(170673) paralemmin
chicken(395709) paralemmin
dog(485098) paralemmin
cow(786096) paralemmin
sheep(101109798) paralemmin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002579 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040134 Rosetta Predictions human pricing
NM_002579 Rosetta Predictions human pricing
NM_130829 Rosetta Predictions rat pricing
NM_023128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179975 predicted 1328
2 SASI_Hs01_00179976 predicted 577
3 SASI_Hs01_00179977 predicted 1434
4 SASI_Hs01_00179978 predicted 593
5 SASI_Hs01_00179979 predicted 1319
6 SASI_Hs01_00179980 predicted 1194
7 SASI_Hs01_00179981 predicted 1418
8 SASI_Hs01_00179982 predicted 1180
9 SASI_Hs01_00179983 predicted 1182
10 SASI_Hs01_00179984 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056715 predicted 1460
2 SASI_Hs01_00056716 predicted 581
3 SASI_Hs01_00056717 predicted 695
4 SASI_Hs01_00056718 predicted 800
5 SASI_Hs01_00056719 predicted 1568
6 SASI_Hs01_00056720 predicted 1449
7 SASI_Hs01_00056721 predicted 695
8 SASI_Hs01_00056722 predicted 1550
9 SASI_Hs01_00056723 predicted 1311
10 SASI_Hs02_00334077 predicted 791
11 SASI_Hs01_00056724 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039437 predicted 1428
2 SASI_Rn01_00039438 predicted 778
3 SASI_Rn01_00039439 predicted 1549
4 SASI_Rn01_00039440 predicted 647
5 SASI_Rn01_00039441 predicted 712
6 SASI_Rn01_00039442 predicted 1401
7 SASI_Rn01_00039443 predicted 1491
8 SASI_Rn01_00039444 predicted 1317
9 SASI_Rn01_00039446 predicted 991
10 SASI_Rn02_00267525 predicted 951
11 SASI_Rn01_00039445 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057057 predicted 934
2 SASI_Mm01_00057058 predicted 911
3 SASI_Mm01_00057059 predicted 990
4 SASI_Mm01_00057060 predicted 835
5 SASI_Mm01_00057061 predicted 619
6 SASI_Mm01_00057062 predicted 279
7 SASI_Mm01_00057063 predicted 513
8 SASI_Mm01_00057064 predicted 816
9 SASI_Mm01_00057065 predicted 954
10 SASI_Mm01_00057066 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002579
VALIDATED
PALM MISSION shRNA Bacterial Glycerol Stock
paralemmin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-1094s21c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-1320s21c1
Sequence:CCGGATGAAGAAGCACCGTTGTAAACTCGAGTTTACAACGGTGCTTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002579.2-1468s21c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-889s21c1
Sequence:CCGGTGGACGAACTCATCCACAAAGCTCGAGCTTTGTGGATGAGTTCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-808s21c1
Sequence:CCGGTCTACGAGGACGAGACCAAAGCTCGAGCTTTGGTCTCGTCCTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1419s1c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1039s1c1
Sequence:CCGGCACAATGATCTTCATGGGTTACTCGAGTAACCCATGAAGATCATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1415s1c1
Sequence:CCGGCTTGGCGTGTTGTTACATGTTCTCGAGAACATGTAACAACACGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1045s1c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002579
VALIDATED
PALM MISSION shRNA shRNA Plasmid DNA
paralemmin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-1094s21c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-1320s21c1
Sequence:CCGGATGAAGAAGCACCGTTGTAAACTCGAGTTTACAACGGTGCTTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002579.2-1468s21c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-889s21c1
Sequence:CCGGTGGACGAACTCATCCACAAAGCTCGAGCTTTGTGGATGAGTTCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-808s21c1
Sequence:CCGGTCTACGAGGACGAGACCAAAGCTCGAGCTTTGGTCTCGTCCTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1419s1c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1039s1c1
Sequence:CCGGCACAATGATCTTCATGGGTTACTCGAGTAACCCATGAAGATCATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1415s1c1
Sequence:CCGGCTTGGCGTGTTGTTACATGTTCTCGAGAACATGTAACAACACGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1045s1c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002579
VALIDATED
PALM MISSION shRNA Lentiviral Transduction Particles
paralemmin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-1094s21c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-1320s21c1
Sequence:CCGGATGAAGAAGCACCGTTGTAAACTCGAGTTTACAACGGTGCTTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002579.2-1468s21c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002579.2-889s21c1
Sequence:CCGGTGGACGAACTCATCCACAAAGCTCGAGCTTTGTGGATGAGTTCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002579.2-808s21c1
Sequence:CCGGTCTACGAGGACGAGACCAAAGCTCGAGCTTTGGTCTCGTCCTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1419s1c1
Sequence:CCGGGCGTGTTGTTACATGTTCCTTCTCGAGAAGGAACATGTAACAACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1039s1c1
Sequence:CCGGCACAATGATCTTCATGGGTTACTCGAGTAACCCATGAAGATCATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1415s1c1
Sequence:CCGGCTTGGCGTGTTGTTACATGTTCTCGAGAACATGTAACAACACGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002579.1-1045s1c1
Sequence:CCGGGATCTTCATGGGTTACCAGAACTCGAGTTCTGGTAACCCATGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023128
VALIDATED
PALM MISSION shRNA Bacterial Glycerol Stock
paralemmin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023128.3-292s21c1
Sequence:CCGGTCGAGAAAGAGATCGATGTTCCTCGAGGAACATCGATCTCTTTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-72s21c1
Sequence:CCGGATCGCTGAGAAGCGTAGGAAGCTCGAGCTTCCTACGCTTCTCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-914s21c1
Sequence:CCGGCATGGTCTTCATGGGTTATCACTCGAGTGATAACCCATGAAGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-626s21c1
Sequence:CCGGGAAAGTCTACGAGGACGAAACCTCGAGGTTTCGTCCTCGTAGACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-222s1c1
Sequence:CCGGCGAGGACATAAGGAAACAGATCTCGAGATCTGTTTCCTTATGTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-503s1c1
Sequence:CCGGCCACAATGATGAAAGCAGCCACTCGAGTGGCTGCTTTCATCATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023128
VALIDATED
PALM MISSION shRNA shRNA Plasmid DNA
paralemmin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023128.3-292s21c1
Sequence:CCGGTCGAGAAAGAGATCGATGTTCCTCGAGGAACATCGATCTCTTTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-72s21c1
Sequence:CCGGATCGCTGAGAAGCGTAGGAAGCTCGAGCTTCCTACGCTTCTCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-914s21c1
Sequence:CCGGCATGGTCTTCATGGGTTATCACTCGAGTGATAACCCATGAAGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-626s21c1
Sequence:CCGGGAAAGTCTACGAGGACGAAACCTCGAGGTTTCGTCCTCGTAGACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-222s1c1
Sequence:CCGGCGAGGACATAAGGAAACAGATCTCGAGATCTGTTTCCTTATGTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-503s1c1
Sequence:CCGGCCACAATGATGAAAGCAGCCACTCGAGTGGCTGCTTTCATCATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023128
VALIDATED
PALM MISSION shRNA Lentiviral Transduction Particles
paralemmin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023128.3-292s21c1
Sequence:CCGGTCGAGAAAGAGATCGATGTTCCTCGAGGAACATCGATCTCTTTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-72s21c1
Sequence:CCGGATCGCTGAGAAGCGTAGGAAGCTCGAGCTTCCTACGCTTCTCAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-914s21c1
Sequence:CCGGCATGGTCTTCATGGGTTATCACTCGAGTGATAACCCATGAAGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023128.3-626s21c1
Sequence:CCGGGAAAGTCTACGAGGACGAAACCTCGAGGTTTCGTCCTCGTAGACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-222s1c1
Sequence:CCGGCGAGGACATAAGGAAACAGATCTCGAGATCTGTTTCCTTATGTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023128.2-503s1c1
Sequence:CCGGCCACAATGATGAAAGCAGCCACTCGAGTGGCTGCTTTCATCATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)