EMAIL THIS PAGE TO A FRIEND

PAM16

presequence translocase-associated motor 16 homolog (S. cerevisiae)

52 Gene Product Result for
Synonyms: MAGMAS TIM16 TIMM16
UniProtKB ID: Q9Y3D7, Q6I9Z3, Q9H5X3
Gene ID:
Mouse(66449) presequence translocase-asssociated motor 16 homolog (S. cerevisiae)
Rat(679907) presequence translocase-associated motor 16 homolog (S. cerevisiae)
Zebrafish(393777) presequence translocase-associated motor 16 homolog (S. cerevisiae)
domestic cat(101094973) presequence translocase-associated motor 16 homolog (S. cerevisiae)
cow(444880) presequence translocase-associated motor 16 homolog (S. cerevisiae)
dog(444856) presequence translocase-associated motor 16 homolog (S. cerevisiae)
chicken(416669) presequence translocase-associated motor 16 homolog (S. cerevisiae)
sheep(101122912) presequence translocase-associated motor 16 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062721 Anti-PAM16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225361 MISSION® esiRNA esiRNA targeting human PAM16 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016069 Rosetta Predictions human pricing
NM_001100136 Rosetta Predictions rat pricing
XM_001054920 Rosetta Predictions rat pricing
NM_025571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168312 predicted 277
2 SASI_Hs01_00168313 predicted 275
3 SASI_Hs01_00168315 predicted 285
4 SASI_Hs01_00168316 predicted 236
5 SASI_Hs02_00348809 predicted 268
6 SASI_Hs01_00168317 predicted 284
7 SASI_Hs01_00168318 predicted 277
8 SASI_Hs01_00168319 predicted 270
9 SASI_Hs01_00168320 predicted 238
10 SASI_Hs01_00168321 predicted 274
11 SASI_Hs01_00168314 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209784 predicted 272
2 SASI_Rn02_00209785 predicted 249
3 SASI_Rn02_00209786 predicted 271
4 SASI_Rn02_00209787 predicted 208
5 SASI_Rn02_00209788 predicted 292
6 SASI_Rn02_00209789 predicted 296
7 SASI_Rn02_00209790 predicted 298
8 SASI_Rn02_00209791 predicted 214
9 SASI_Rn02_00209792 predicted 304
10 SASI_Rn02_00209793 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277714 predicted 255
2 SASI_Rn02_00277715 predicted 398
3 SASI_Rn02_00277716 predicted 325
4 SASI_Rn02_00277717 predicted 288
5 SASI_Rn02_00277718 predicted 431
6 SASI_Rn02_00277719 predicted 300
7 SASI_Rn02_00277720 predicted 424
8 SASI_Rn02_00277721 predicted 291
9 SASI_Rn02_00277722 predicted 208
10 SASI_Rn02_00277723 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191302 predicted 270
2 SASI_Mm01_00191303 predicted 316
3 SASI_Mm01_00191304 predicted 319
4 SASI_Mm01_00191305 predicted 322
5 SASI_Mm01_00191306 predicted 265
6 SASI_Mm01_00191307 predicted 309
7 SASI_Mm01_00191308 predicted 323
8 SASI_Mm01_00191309 predicted 314
9 SASI_Mm01_00191310 predicted 199
10 SASI_Mm01_00191311 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016069
PAM16 MISSION shRNA Bacterial Glycerol Stock
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-323s21c1
Sequence:CCGGATCCGTGGGTGGCTCCTTCTACTCGAGTAGAAGGAGCCACCCACGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-336s21c1
Sequence:CCGGTCCTTCTACCTGCAGTCAAAGCTCGAGCTTTGACTGCAGGTAGAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-300s21c1
Sequence:CCGGCACTTATTTAAGGTGAATGATCTCGAGATCATTCACCTTAAATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-246s1c1
Sequence:CCGGCAGATTCTCAACGTGTCCAAGCTCGAGCTTGGACACGTTGAGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-248s1c1
Sequence:CCGGGATTCTCAACGTGTCCAAGCTCTCGAGAGCTTGGACACGTTGAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-245s1c1
Sequence:CCGGGCAGATTCTCAACGTGTCCAACTCGAGTTGGACACGTTGAGAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-284s1c1
Sequence:CCGGCCAGAAGAACTATGAACACTTCTCGAGAAGTGTTCATAGTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-241s1c1
Sequence:CCGGCACAGCAGATTCTCAACGTGTCTCGAGACACGTTGAGAATCTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016069.8-338s1c1
Sequence:CCGGCTTCTACCTGCAGTCAAAGGTCTCGAGACCTTTGACTGCAGGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016069
PAM16 MISSION shRNA shRNA Plasmid DNA
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-323s21c1
Sequence:CCGGATCCGTGGGTGGCTCCTTCTACTCGAGTAGAAGGAGCCACCCACGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-336s21c1
Sequence:CCGGTCCTTCTACCTGCAGTCAAAGCTCGAGCTTTGACTGCAGGTAGAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-300s21c1
Sequence:CCGGCACTTATTTAAGGTGAATGATCTCGAGATCATTCACCTTAAATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-246s1c1
Sequence:CCGGCAGATTCTCAACGTGTCCAAGCTCGAGCTTGGACACGTTGAGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-248s1c1
Sequence:CCGGGATTCTCAACGTGTCCAAGCTCTCGAGAGCTTGGACACGTTGAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-245s1c1
Sequence:CCGGGCAGATTCTCAACGTGTCCAACTCGAGTTGGACACGTTGAGAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-284s1c1
Sequence:CCGGCCAGAAGAACTATGAACACTTCTCGAGAAGTGTTCATAGTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-241s1c1
Sequence:CCGGCACAGCAGATTCTCAACGTGTCTCGAGACACGTTGAGAATCTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016069.8-338s1c1
Sequence:CCGGCTTCTACCTGCAGTCAAAGGTCTCGAGACCTTTGACTGCAGGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016069
PAM16 MISSION shRNA Lentiviral Transduction Particles
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-323s21c1
Sequence:CCGGATCCGTGGGTGGCTCCTTCTACTCGAGTAGAAGGAGCCACCCACGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-336s21c1
Sequence:CCGGTCCTTCTACCTGCAGTCAAAGCTCGAGCTTTGACTGCAGGTAGAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016069.8-300s21c1
Sequence:CCGGCACTTATTTAAGGTGAATGATCTCGAGATCATTCACCTTAAATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-246s1c1
Sequence:CCGGCAGATTCTCAACGTGTCCAAGCTCGAGCTTGGACACGTTGAGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-248s1c1
Sequence:CCGGGATTCTCAACGTGTCCAAGCTCTCGAGAGCTTGGACACGTTGAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-245s1c1
Sequence:CCGGGCAGATTCTCAACGTGTCCAACTCGAGTTGGACACGTTGAGAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-284s1c1
Sequence:CCGGCCAGAAGAACTATGAACACTTCTCGAGAAGTGTTCATAGTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016069.8-241s1c1
Sequence:CCGGCACAGCAGATTCTCAACGTGTCTCGAGACACGTTGAGAATCTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016069.8-338s1c1
Sequence:CCGGCTTCTACCTGCAGTCAAAGGTCTCGAGACCTTTGACTGCAGGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025571
PAM16 MISSION shRNA Bacterial Glycerol Stock
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-312s1c1
Sequence:CCGGCCAGAAGAATTATGAACACCTCTCGAGAGGTGTTCATAATTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-310s1c1
Sequence:CCGGGTCCAGAAGAATTATGAACACCTCGAGGTGTTCATAATTCTTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-363s1c1
Sequence:CCGGCTCTTTCTACCTGCAGTCAAACTCGAGTTTGACTGCAGGTAGAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-307s1c1
Sequence:CCGGGAGGTCCAGAAGAATTATGAACTCGAGTTCATAATTCTTCTGGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-313s1c1
Sequence:CCGGCAGAAGAATTATGAACACCTACTCGAGTAGGTGTTCATAATTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025571
PAM16 MISSION shRNA shRNA Plasmid DNA
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-312s1c1
Sequence:CCGGCCAGAAGAATTATGAACACCTCTCGAGAGGTGTTCATAATTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-310s1c1
Sequence:CCGGGTCCAGAAGAATTATGAACACCTCGAGGTGTTCATAATTCTTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-363s1c1
Sequence:CCGGCTCTTTCTACCTGCAGTCAAACTCGAGTTTGACTGCAGGTAGAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-307s1c1
Sequence:CCGGGAGGTCCAGAAGAATTATGAACTCGAGTTCATAATTCTTCTGGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-313s1c1
Sequence:CCGGCAGAAGAATTATGAACACCTACTCGAGTAGGTGTTCATAATTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025571
PAM16 MISSION shRNA Lentiviral Transduction Particles
presequence translocase-associated motor 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-312s1c1
Sequence:CCGGCCAGAAGAATTATGAACACCTCTCGAGAGGTGTTCATAATTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-310s1c1
Sequence:CCGGGTCCAGAAGAATTATGAACACCTCGAGGTGTTCATAATTCTTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-363s1c1
Sequence:CCGGCTCTTTCTACCTGCAGTCAAACTCGAGTTTGACTGCAGGTAGAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-307s1c1
Sequence:CCGGGAGGTCCAGAAGAATTATGAACTCGAGTTCATAATTCTTCTGGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025571.1-313s1c1
Sequence:CCGGCAGAAGAATTATGAACACCTACTCGAGTAGGTGTTCATAATTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)