EMAIL THIS PAGE TO A FRIEND

PAM

peptidylglycine alpha-amidating monooxygenase

84 Gene Product Result for
Synonyms: PAL PHM
Gene ID:
Human(5066) Summary: This gene encodes a multifunctional protein. It has two enzymatically active domains with catalytic activities - peptidylglycine alpha-hydroxylating monooxygenase (PHM) and peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL). These catalytic domains work sequentially to catalyze neuroendocrine peptides to active alpha-amidated products. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene but some of their full length sequences are not yet known. [provided by RefSeq, Jul 2008]
Mouse(18484) peptidylglycine alpha-amidating monooxygenase
Rat(25508) peptidylglycine alpha-amidating monooxygenase
Zebrafish(570822) peptidylglycine alpha-amidating monooxygenase
chicken(427274) peptidylglycine alpha-amidating monooxygenase
cow(280890) peptidylglycine alpha-amidating monooxygenase
Horse(791244) peptidylglycine alpha-amidating monooxygenase
domestic cat(101084598) peptidylglycine alpha-amidating monooxygenase
dog(479145) peptidylglycine alpha-amidating monooxygenase
domestic guinea pig(100713254) peptidylglycine alpha-amidating monooxygenase
Domestic Rabbit(100352005) peptidylglycine alpha-amidating monooxygenase
naked mole-rat(101716909) peptidylglycine alpha-amidating monooxygenase
sheep(101112815) peptidylglycine alpha-amidating monooxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000919 Rosetta Predictions human pricing
NM_138766 Rosetta Predictions human pricing
NM_138821 Rosetta Predictions human pricing
NM_138822 Rosetta Predictions human pricing
NM_013000 Rosetta Predictions rat pricing
NM_013626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123379 predicted 3353
2 SASI_Hs01_00123380 predicted 1087
3 SASI_Hs01_00123382 predicted 2620
4 SASI_Hs01_00123383 predicted 1299
5 SASI_Hs01_00123384 predicted 2506
6 SASI_Hs01_00123385 predicted 566
7 SASI_Hs01_00123386 predicted 2352
8 SASI_Hs01_00123387 predicted 2141
9 SASI_Hs01_00123388 predicted 2635
10 SASI_Hs02_00303495 predicted 2208
11 SASI_Hs01_00123381 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165826 predicted 3149
2 SASI_Hs01_00165827 predicted 1085
3 SASI_Hs01_00165829 predicted 2627
4 SASI_Hs01_00165830 predicted 1296
5 SASI_Hs01_00165831 predicted 2512
6 SASI_Hs01_00165832 predicted 568
7 SASI_Hs01_00165833 predicted 2356
8 SASI_Hs01_00165834 predicted 2133
9 SASI_Hs01_00165835 predicted 2630
10 SASI_Hs02_00363883 predicted 2210
11 SASI_Hs01_00165828 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166324 predicted 3028
2 SASI_Hs01_00166325 predicted 1082
3 SASI_Hs01_00166327 predicted 2305
4 SASI_Hs01_00166328 predicted 1293
5 SASI_Hs01_00166329 predicted 2189
6 SASI_Hs01_00166330 predicted 565
7 SASI_Hs01_00166331 predicted 2030
8 SASI_Hs01_00166332 predicted 1816
9 SASI_Hs01_00166333 predicted 2314
10 SASI_Hs02_00363991 predicted 1890
11 SASI_Hs01_00166326 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191116 predicted 3091
2 SASI_Hs01_00191117 predicted 1084
3 SASI_Hs01_00191119 predicted 2621
4 SASI_Hs01_00191120 predicted 1299
5 SASI_Hs01_00191121 predicted 2506
6 SASI_Hs01_00191122 predicted 567
7 SASI_Hs01_00191123 predicted 2348
8 SASI_Hs01_00191124 predicted 2133
9 SASI_Hs01_00191125 predicted 2630
10 SASI_Hs02_00363992 predicted 2210
11 SASI_Hs01_00191118 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082328 predicted 1237
2 SASI_Rn01_00082329 predicted 918
3 SASI_Rn01_00082330 predicted 390
4 SASI_Rn01_00082331 predicted 401
5 SASI_Rn01_00082332 predicted 1875
6 SASI_Rn01_00082333 predicted 1811
7 SASI_Rn01_00082334 predicted 1820
8 SASI_Rn02_00260652 predicted 1952
9 SASI_Rn01_00082335 predicted 1336
10 SASI_Rn02_00260653 predicted 1742
11 SASI_Rn01_00082327 predicted 2147
12 SASI_Rn01_00082336 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180425 predicted 1838
2 SASI_Mm01_00180426 predicted 1445
3 SASI_Mm01_00180427 predicted 2598
4 SASI_Mm01_00180428 predicted 2198
5 SASI_Mm01_00180429 predicted 858
6 SASI_Mm01_00180430 predicted 1384
7 SASI_Mm01_00180431 predicted 601
8 SASI_Mm01_00180432 predicted 3441
9 SASI_Mm01_00180433 predicted 1170
10 SASI_Mm01_00180434 predicted 2546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000919
VALIDATED
PAM MISSION shRNA Bacterial Glycerol Stock
peptidylglycine alpha-amidating monooxygenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-3349s21c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3349s1c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3023s1c1
Sequence:CCGGGCCATATTTATTCGGTGGAAACTCGAGTTTCCACCGAATAAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-1934s1c1
Sequence:CCGGCCTAAGAATAACCTGGTGATTCTCGAGAATCACCAGGTTATTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-952s1c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-516s1c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-2806s21c1
Sequence:CCGGATTGGAACATCGATCAGTTAACTCGAGTTAACTGATCGATGTTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-516s21c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-952s21c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-1291s21c1
Sequence:CCGGTGATGAAATGTGCAACTTATACTCGAGTATAAGTTGCACATTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000919
VALIDATED
PAM MISSION shRNA shRNA Plasmid DNA
peptidylglycine alpha-amidating monooxygenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-3349s21c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3349s1c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3023s1c1
Sequence:CCGGGCCATATTTATTCGGTGGAAACTCGAGTTTCCACCGAATAAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-1934s1c1
Sequence:CCGGCCTAAGAATAACCTGGTGATTCTCGAGAATCACCAGGTTATTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-952s1c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-516s1c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-2806s21c1
Sequence:CCGGATTGGAACATCGATCAGTTAACTCGAGTTAACTGATCGATGTTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-516s21c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-952s21c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-1291s21c1
Sequence:CCGGTGATGAAATGTGCAACTTATACTCGAGTATAAGTTGCACATTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000919
VALIDATED
PAM MISSION shRNA Lentiviral Transduction Particles
peptidylglycine alpha-amidating monooxygenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-3349s21c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3349s1c1
Sequence:CCGGCCTTTCCCTTTAGCACGTTTACTCGAGTAAACGTGCTAAAGGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-3023s1c1
Sequence:CCGGGCCATATTTATTCGGTGGAAACTCGAGTTTCCACCGAATAAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-1934s1c1
Sequence:CCGGCCTAAGAATAACCTGGTGATTCTCGAGAATCACCAGGTTATTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-952s1c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000919.2-516s1c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-2806s21c1
Sequence:CCGGATTGGAACATCGATCAGTTAACTCGAGTTAACTGATCGATGTTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-516s21c1
Sequence:CCGGCCGTAGTTCCTATTGATTCATCTCGAGATGAATCAATAGGAACTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-952s21c1
Sequence:CCGGGCCTTTAATTGCTGGCATGTACTCGAGTACATGCCAGCAATTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000919.2-1291s21c1
Sequence:CCGGTGATGAAATGTGCAACTTATACTCGAGTATAAGTTGCACATTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013626
VALIDATED
PAM MISSION shRNA Bacterial Glycerol Stock
peptidylglycine alpha-amidating monooxygenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-1253s1c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-779s1c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3003s1c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3109s1c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3343s1c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013626.3-3456s21c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-894s21c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-1368s21c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3221s21c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3115s21c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013626
VALIDATED
PAM MISSION shRNA shRNA Plasmid DNA
peptidylglycine alpha-amidating monooxygenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-1253s1c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-779s1c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3003s1c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3109s1c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3343s1c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013626.3-3456s21c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-894s21c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-1368s21c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3221s21c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3115s21c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013626
VALIDATED
PAM MISSION shRNA Lentiviral Transduction Particles
peptidylglycine alpha-amidating monooxygenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-1253s1c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-779s1c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3003s1c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3109s1c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013626.1-3343s1c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013626.3-3456s21c1
Sequence:CCGGGCGTGTAAAGTTCTGTGCATTCTCGAGAATGCACAGAACTTTACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-894s21c1
Sequence:CCGGGCTCCCTAAAGGTGTTGGATTCTCGAGAATCCAACACCTTTAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-1368s21c1
Sequence:CCGGCGGCACATCTAGTGATGAAATCTCGAGATTTCATCACTAGATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3221s21c1
Sequence:CCGGGCGGCTTAAATCTAGGAAATTCTCGAGAATTTCCTAGATTTAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013626.3-3115s21c1
Sequence:CCGGGCCATGTTTATTCGATGGAAACTCGAGTTTCCATCGAATAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)