EMAIL THIS PAGE TO A FRIEND

PAMR1

peptidase domain containing associated with muscle regeneration 1

73 Gene Product Result for
Synonyms: DKFZP586H2123 RAMP
Gene ID:
Mouse(210622) peptidase domain containing associated with muscle regeneration 1
Rat(311252) peptidase domain containing associated with muscle regeneration 1
chicken(423158) peptidase domain containing associated with muscle regeneration 1
cow(513841) peptidase domain containing associated with muscle regeneration 1
Horse(100067176) peptidase domain containing associated with muscle regeneration 1
domestic cat(101095770) peptidase domain containing associated with muscle regeneration 1
dog(483426) peptidase domain containing associated with muscle regeneration 1
domestic guinea pig(100725275) peptidase domain containing associated with muscle regeneration 1
naked mole-rat(101700664) peptidase domain containing associated with muscle regeneration 1
sheep(101106200) peptidase domain containing associated with muscle regeneration 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001991 Rosetta Predictions human pricing
NM_015430 Rosetta Predictions human pricing
NM_001107755 Rosetta Predictions rat pricing
NM_173749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071543 predicted 567
2 SASI_Hs01_00071544 predicted 1140
3 SASI_Hs01_00071545 predicted 1669
4 SASI_Hs01_00071546 predicted 1223
5 SASI_Hs01_00071547 predicted 594
6 SASI_Hs01_00071548 predicted 337
7 SASI_Hs01_00071549 predicted 480
8 SASI_Hs01_00071550 predicted 1841
9 SASI_Hs01_00071551 predicted 1127
10 SASI_Hs01_00071552 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119237 predicted 568
2 SASI_Hs01_00119238 predicted 1190
3 SASI_Hs01_00119239 predicted 1717
4 SASI_Hs01_00119240 predicted 1274
5 SASI_Hs01_00119241 predicted 602
6 SASI_Hs01_00119242 predicted 337
7 SASI_Hs01_00119243 predicted 481
8 SASI_Hs01_00119244 predicted 1886
9 SASI_Hs01_00119245 predicted 1177
10 SASI_Hs01_00119246 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231945 predicted 1117
2 SASI_Rn02_00231946 predicted 1181
3 SASI_Rn02_00231947 predicted 380
4 SASI_Rn02_00231948 predicted 459
5 SASI_Rn02_00231949 predicted 567
6 SASI_Rn02_00231950 predicted 451
7 SASI_Rn02_00231951 predicted 1105
8 SASI_Rn02_00231952 predicted 1106
9 SASI_Rn02_00231953 predicted 544
10 SASI_Rn02_00231954 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080099 predicted 447
2 SASI_Mm01_00080100 predicted 2017
3 SASI_Mm01_00080102 predicted 2262
4 SASI_Mm01_00080104 predicted 2306
5 SASI_Mm01_00080105 predicted 2237
6 SASI_Mm02_00345391 predicted 255
7 SASI_Mm01_00080106 predicted 1800
8 SASI_Mm02_00345392 predicted 229
9 SASI_Mm01_00080107 predicted 1781
10 SASI_Mm01_00080108 predicted 599
11 SASI_Mm01_00080101 predicted 243
12 SASI_Mm01_00080103 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173749
PAMR1 MISSION shRNA Bacterial Glycerol Stock
peptidase domain containing associated with muscle regeneration 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1735s1c1
Sequence:CCGGGCATCCAGAATTTACGGGTTTCTCGAGAAACCCGTAAATTCTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-2194s1c1
Sequence:CCGGGCTGGAGCTATGACAAGACATCTCGAGATGTCTTGTCATAGCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-878s1c1
Sequence:CCGGCCTTGACACAACTGGGTCTTTCTCGAGAAAGACCCAGTTGTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1951s1c1
Sequence:CCGGGCCCTGGCTTTAAGAATGATACTCGAGTATCATTCTTAAAGCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-192s1c1
Sequence:CCGGCCAAGAGAGTACACGGTCATTCTCGAGAATGACCGTGTACTCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173749
PAMR1 MISSION shRNA shRNA Plasmid DNA
peptidase domain containing associated with muscle regeneration 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1735s1c1
Sequence:CCGGGCATCCAGAATTTACGGGTTTCTCGAGAAACCCGTAAATTCTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-2194s1c1
Sequence:CCGGGCTGGAGCTATGACAAGACATCTCGAGATGTCTTGTCATAGCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-878s1c1
Sequence:CCGGCCTTGACACAACTGGGTCTTTCTCGAGAAAGACCCAGTTGTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1951s1c1
Sequence:CCGGGCCCTGGCTTTAAGAATGATACTCGAGTATCATTCTTAAAGCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-192s1c1
Sequence:CCGGCCAAGAGAGTACACGGTCATTCTCGAGAATGACCGTGTACTCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173749
PAMR1 MISSION shRNA Lentiviral Transduction Particles
peptidase domain containing associated with muscle regeneration 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1735s1c1
Sequence:CCGGGCATCCAGAATTTACGGGTTTCTCGAGAAACCCGTAAATTCTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-2194s1c1
Sequence:CCGGGCTGGAGCTATGACAAGACATCTCGAGATGTCTTGTCATAGCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-878s1c1
Sequence:CCGGCCTTGACACAACTGGGTCTTTCTCGAGAAAGACCCAGTTGTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-1951s1c1
Sequence:CCGGGCCCTGGCTTTAAGAATGATACTCGAGTATCATTCTTAAAGCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173749.3-192s1c1
Sequence:CCGGCCAAGAGAGTACACGGTCATTCTCGAGAATGACCGTGTACTCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015430
PAMR1 MISSION shRNA Bacterial Glycerol Stock
peptidase domain containing associated with muscle regeneration 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1131s1c1
Sequence:CCGGCCTGCCGAGAACCAAAGATTTCTCGAGAAATCTTTGGTTCTCGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-112s1c1
Sequence:CCGGGCCAAGAGAGTACACAGTCATCTCGAGATGACTGTGTACTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1714s1c1
Sequence:CCGGGAGCCTACAGATTTCTGCTATCTCGAGATAGCAGAAATCTGTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-293s1c1
Sequence:CCGGCCAGGTTGTACCATCTTTGAACTCGAGTTCAAAGATGGTACAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-532s1c1
Sequence:CCGGCCAACTAAGATTTGTCATGTTCTCGAGAACATGACAAATCTTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-2158s21c1
Sequence:CCGGGGTCAGCTGGAGCTATGATAACTCGAGTTATCATAGCTCCAGCTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-722s21c1
Sequence:CCGGGACGGTTTCCATGCCATTTATCTCGAGATAAATGGCATGGAAACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015430
PAMR1 MISSION shRNA shRNA Plasmid DNA
peptidase domain containing associated with muscle regeneration 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1131s1c1
Sequence:CCGGCCTGCCGAGAACCAAAGATTTCTCGAGAAATCTTTGGTTCTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-112s1c1
Sequence:CCGGGCCAAGAGAGTACACAGTCATCTCGAGATGACTGTGTACTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1714s1c1
Sequence:CCGGGAGCCTACAGATTTCTGCTATCTCGAGATAGCAGAAATCTGTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-293s1c1
Sequence:CCGGCCAGGTTGTACCATCTTTGAACTCGAGTTCAAAGATGGTACAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-532s1c1
Sequence:CCGGCCAACTAAGATTTGTCATGTTCTCGAGAACATGACAAATCTTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-2158s21c1
Sequence:CCGGGGTCAGCTGGAGCTATGATAACTCGAGTTATCATAGCTCCAGCTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-722s21c1
Sequence:CCGGGACGGTTTCCATGCCATTTATCTCGAGATAAATGGCATGGAAACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015430
PAMR1 MISSION shRNA Lentiviral Transduction Particles
peptidase domain containing associated with muscle regeneration 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1131s1c1
Sequence:CCGGCCTGCCGAGAACCAAAGATTTCTCGAGAAATCTTTGGTTCTCGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-112s1c1
Sequence:CCGGGCCAAGAGAGTACACAGTCATCTCGAGATGACTGTGTACTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-1714s1c1
Sequence:CCGGGAGCCTACAGATTTCTGCTATCTCGAGATAGCAGAAATCTGTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-293s1c1
Sequence:CCGGCCAGGTTGTACCATCTTTGAACTCGAGTTCAAAGATGGTACAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015430.1-532s1c1
Sequence:CCGGCCAACTAAGATTTGTCATGTTCTCGAGAACATGACAAATCTTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-2158s21c1
Sequence:CCGGGGTCAGCTGGAGCTATGATAACTCGAGTTATCATAGCTCCAGCTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015430.2-722s21c1
Sequence:CCGGGACGGTTTCCATGCCATTTATCTCGAGATAAATGGCATGGAAACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)