EMAIL THIS PAGE TO A FRIEND

PAN2

PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)

116 Gene Product Result for
Synonyms: USP52
UniProtKB ID: Q504Q3, O75189, Q76E12, Q8IVE1
Gene ID:
Human(9924) Summary: This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(103135) PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae)
Rat(408200) PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae)
Zebrafish(324393) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
domestic cat(101098726) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
cow(538820) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Horse(100052396) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
dog(474404) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
chicken(429172) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
sheep(101108473) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
naked mole-rat(101708269) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Domestic Rabbit(100351819) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
domestic guinea pig(100732969) PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127460 Rosetta Predictions human pricing
NM_014871 Rosetta Predictions human pricing
NM_001008862 Rosetta Predictions rat pricing
NM_133992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329594 predicted 3671
2 SASI_Hs02_00329595 predicted 3090
3 SASI_Hs02_00329596 predicted 550
4 SASI_Hs02_00329597 predicted 3538
5 SASI_Hs02_00329598 predicted 1953
6 SASI_Hs02_00329599 predicted 3339
7 SASI_Hs02_00329600 predicted 3476
8 SASI_Hs02_00329601 predicted 534
9 SASI_Hs02_00329602 predicted 2840
10 SASI_Hs02_00329603 predicted 3709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133440 predicted 3589
2 SASI_Hs01_00133442 predicted 3003
3 SASI_Hs01_00133443 predicted 465
4 SASI_Hs01_00133444 predicted 3449
5 SASI_Hs01_00133445 predicted 1874
6 SASI_Hs01_00133446 predicted 3249
7 SASI_Hs02_00346473 predicted 3382
8 SASI_Hs01_00133447 predicted 455
9 SASI_Hs02_00346474 predicted 2744
10 SASI_Hs01_00133448 predicted 3619
11 SASI_Hs01_00133439 predicted 2951
12 SASI_Hs01_00133441 predicted 2536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116819 predicted 2739
2 SASI_Rn01_00116820 predicted 1717
3 SASI_Rn01_00116821 predicted 1473
4 SASI_Rn01_00116822 predicted 2149
5 SASI_Rn01_00116823 predicted 2308
6 SASI_Rn01_00116824 predicted 3329
7 SASI_Rn02_00199381 predicted 337
8 SASI_Rn01_00116825 predicted 1583
9 SASI_Rn01_00116826 predicted 1349
10 SASI_Rn01_00116827 predicted 1724
11 SASI_Rn01_00116828 predicted 3174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147353 predicted 2969
2 SASI_Mm02_00339130 predicted 3215
3 SASI_Mm01_00147354 predicted 3585
4 SASI_Mm01_00147355 predicted 1838
5 SASI_Mm01_00147357 predicted 1970
6 SASI_Mm01_00147358 predicted 3557
7 SASI_Mm01_00147359 predicted 3904
8 SASI_Mm01_00147360 predicted 2642
9 SASI_Mm01_00147361 predicted 427
10 SASI_Mm02_00339131 predicted 418
11 SASI_Mm01_00147352 predicted 1736
12 SASI_Mm01_00147356 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133992
VALIDATED
PAN2 MISSION shRNA Bacterial Glycerol Stock
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2994s21c1
Sequence:CCGGGTACCTGCTATCCTGTATTATCTCGAGATAATACAGGATAGCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2437s21c1
Sequence:CCGGTCCGACATCTGCCAGATATTCCTCGAGGAATATCTGGCAGATGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-1842s21c1
Sequence:CCGGATGATCCAGGTGCTCTATTTCCTCGAGGAAATAGAGCACCTGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-3433s21c1
Sequence:CCGGCCCTCAAGTCTACCTACTTAACTCGAGTTAAGTAGGTAGACTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-4080s21c1
Sequence:CCGGAGTGATTGGTGTTCGTAATAACTCGAGTTATTACGAACACCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-1610s21c1
Sequence:CCGGCCAGATTCCCTATCGACTAAACTCGAGTTTAGTCGATAGGGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-592s21c1
Sequence:CCGGTCAATGGTGGTGACGACATTCCTCGAGGAATGTCGTCACCACCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-676s21c1
Sequence:CCGGCCCGTGGAGGGCTCATTATATCTCGAGATATAATGAGCCCTCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1246s1c1
Sequence:CCGGCCTTTGCTAATGACGTTTGATCTCGAGATCAAACGTCATTAGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3187s1c1
Sequence:CCGGGCCGAGTTTGTCACTCTTAATCTCGAGATTAAGAGTGACAAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-2968s1c1
Sequence:CCGGGCCGTGCAGTTTGACATGAATCTCGAGATTCATGTCAAACTGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1704s1c1
Sequence:CCGGCCACACAGTTTCTAAGAAATACTCGAGTATTTCTTAGAAACTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3681s1c1
Sequence:CCGGCCTTCAACTCTACCGGAAGTACTCGAGTACTTCCGGTAGAGTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133992
VALIDATED
PAN2 MISSION shRNA shRNA Plasmid DNA
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2994s21c1
Sequence:CCGGGTACCTGCTATCCTGTATTATCTCGAGATAATACAGGATAGCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2437s21c1
Sequence:CCGGTCCGACATCTGCCAGATATTCCTCGAGGAATATCTGGCAGATGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-1842s21c1
Sequence:CCGGATGATCCAGGTGCTCTATTTCCTCGAGGAAATAGAGCACCTGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-3433s21c1
Sequence:CCGGCCCTCAAGTCTACCTACTTAACTCGAGTTAAGTAGGTAGACTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-4080s21c1
Sequence:CCGGAGTGATTGGTGTTCGTAATAACTCGAGTTATTACGAACACCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-1610s21c1
Sequence:CCGGCCAGATTCCCTATCGACTAAACTCGAGTTTAGTCGATAGGGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-592s21c1
Sequence:CCGGTCAATGGTGGTGACGACATTCCTCGAGGAATGTCGTCACCACCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-676s21c1
Sequence:CCGGCCCGTGGAGGGCTCATTATATCTCGAGATATAATGAGCCCTCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1246s1c1
Sequence:CCGGCCTTTGCTAATGACGTTTGATCTCGAGATCAAACGTCATTAGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3187s1c1
Sequence:CCGGGCCGAGTTTGTCACTCTTAATCTCGAGATTAAGAGTGACAAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-2968s1c1
Sequence:CCGGGCCGTGCAGTTTGACATGAATCTCGAGATTCATGTCAAACTGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1704s1c1
Sequence:CCGGCCACACAGTTTCTAAGAAATACTCGAGTATTTCTTAGAAACTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3681s1c1
Sequence:CCGGCCTTCAACTCTACCGGAAGTACTCGAGTACTTCCGGTAGAGTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133992
VALIDATED
PAN2 MISSION shRNA Lentiviral Transduction Particles
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2994s21c1
Sequence:CCGGGTACCTGCTATCCTGTATTATCTCGAGATAATACAGGATAGCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-2437s21c1
Sequence:CCGGTCCGACATCTGCCAGATATTCCTCGAGGAATATCTGGCAGATGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-1842s21c1
Sequence:CCGGATGATCCAGGTGCTCTATTTCCTCGAGGAAATAGAGCACCTGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-3433s21c1
Sequence:CCGGCCCTCAAGTCTACCTACTTAACTCGAGTTAAGTAGGTAGACTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-4080s21c1
Sequence:CCGGAGTGATTGGTGTTCGTAATAACTCGAGTTATTACGAACACCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133992.2-1610s21c1
Sequence:CCGGCCAGATTCCCTATCGACTAAACTCGAGTTTAGTCGATAGGGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-592s21c1
Sequence:CCGGTCAATGGTGGTGACGACATTCCTCGAGGAATGTCGTCACCACCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133992.2-676s21c1
Sequence:CCGGCCCGTGGAGGGCTCATTATATCTCGAGATATAATGAGCCCTCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1246s1c1
Sequence:CCGGCCTTTGCTAATGACGTTTGATCTCGAGATCAAACGTCATTAGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3187s1c1
Sequence:CCGGGCCGAGTTTGTCACTCTTAATCTCGAGATTAAGAGTGACAAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-2968s1c1
Sequence:CCGGGCCGTGCAGTTTGACATGAATCTCGAGATTCATGTCAAACTGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-1704s1c1
Sequence:CCGGCCACACAGTTTCTAAGAAATACTCGAGTATTTCTTAGAAACTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133992.1-3681s1c1
Sequence:CCGGCCTTCAACTCTACCGGAAGTACTCGAGTACTTCCGGTAGAGTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014871
VALIDATED
PAN2 MISSION shRNA Bacterial Glycerol Stock
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1153s21c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-2706s21c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014871.3-3916s21c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-639s21c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1800s21c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014871.x-1709s1c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-3960s1c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-2624s1c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-548s1c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-1062s1c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014871
VALIDATED
PAN2 MISSION shRNA shRNA Plasmid DNA
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1153s21c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-2706s21c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014871.3-3916s21c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-639s21c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1800s21c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014871.x-1709s1c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-3960s1c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-2624s1c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-548s1c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-1062s1c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014871
VALIDATED
PAN2 MISSION shRNA Lentiviral Transduction Particles
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1153s21c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-2706s21c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014871.3-3916s21c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-639s21c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014871.3-1800s21c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014871.x-1709s1c1
Sequence:CCGGGCTGGAGGACTTTGACTTCAACTCGAGTTGAAGTCAAAGTCCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-3960s1c1
Sequence:CCGGCCTCTCCCTTTACTGTTCTATCTCGAGATAGAACAGTAAAGGGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-2624s1c1
Sequence:CCGGGCTTCCTTTCTCCATTCGCATCTCGAGATGCGAATGGAGAAAGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-548s1c1
Sequence:CCGGCAGTGATGATATTCGGCAGATCTCGAGATCTGCCGAATATCATCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014871.x-1062s1c1
Sequence:CCGGCCTGCCTTCTTGCGCTTCATTCTCGAGAATGAAGCGCAAGAAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)