EMAIL THIS PAGE TO A FRIEND

PANK1

pantothenate kinase 1

183 Gene Product Result for
Synonyms: PANK
UniProtKB ID: Q8TE04, A6NIP0, Q7RTX6, Q7Z495, Q8TBQ8
Gene ID:
Human(53354) Summary: This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
Mouse(75735) pantothenate kinase 1
Rat(294088) pantothenate kinase 1
Thale Cress(842339) Pantothenate kinase 1
dog(486790) pantothenate kinase 1
cow(535887) pantothenate kinase 1
domestic cat(101101593) pantothenate kinase 1
chicken(423792) pantothenate kinase 1
domestic guinea pig(100718507) pantothenate kinase 1
naked mole-rat(101717132) pantothenate kinase 1
Domestic Rabbit(100339088) pantothenate kinase 1
sheep(101122150) pantothenate kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138316 Rosetta Predictions human pricing
NM_148977 Rosetta Predictions human pricing
NM_148978 Rosetta Predictions human pricing
NM_001106373 Rosetta Predictions rat pricing
NM_001114339 Rosetta Predictions mouse pricing
NM_023792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030049 predicted 421
2 SASI_Hs01_00030050 predicted 431
3 SASI_Hs01_00030051 predicted 464
4 SASI_Hs01_00030052 predicted 1072
5 SASI_Hs02_00363401 predicted 509
6 SASI_Hs01_00030053 predicted 403
7 SASI_Hs01_00030054 predicted 912
8 SASI_Hs01_00030055 predicted 582
9 SASI_Hs01_00030056 predicted 691
10 SASI_Hs01_00030057 predicted 659
11 SASI_Hs01_00030058 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067614 predicted 1078
2 SASI_Hs01_00067615 predicted 1097
3 SASI_Hs01_00067617 predicted 1133
4 SASI_Hs01_00067618 predicted 1907
5 SASI_Hs01_00067616 predicted 1055
6 SASI_Hs02_00365693 predicted 1075
7 SASI_Hs01_00067619 predicted 1247
8 SASI_Hs01_00067620 predicted 1325
9 SASI_Hs01_00067621 predicted 977
10 SASI_Hs01_00067623 predicted 1716
11 SASI_Hs01_00067622 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234241 predicted 420
2 SASI_Hs01_00234242 predicted 430
3 SASI_Hs01_00234243 predicted 468
4 SASI_Hs01_00234244 predicted 1242
5 SASI_Hs02_00365694 predicted 509
6 SASI_Hs01_00234245 predicted 411
7 SASI_Hs01_00234246 predicted 586
8 SASI_Hs01_00234247 predicted 659
9 SASI_Hs01_00234248 predicted 313
10 SASI_Hs01_00234250 predicted 1050
11 SASI_Hs01_00234249 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218328 predicted 624
2 SASI_Rn02_00218329 predicted 1145
3 SASI_Rn02_00218330 predicted 1110
4 SASI_Rn02_00218331 predicted 670
5 SASI_Rn02_00218332 predicted 525
6 SASI_Rn02_00218333 predicted 608
7 SASI_Rn02_00218334 predicted 719
8 SASI_Rn02_00218335 predicted 1069
9 SASI_Rn02_00218336 predicted 1158
10 SASI_Rn02_00218337 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308560 predicted 1869
2 SASI_Mm02_00308561 predicted 1844
3 SASI_Mm02_00308562 predicted 1401
4 SASI_Mm02_00308563 predicted 1317
5 SASI_Mm02_00308564 predicted 1892
6 SASI_Mm02_00308565 predicted 1445
7 SASI_Mm02_00308566 predicted 1809
8 SASI_Mm02_00308567 predicted 1149
9 SASI_Mm02_00308568 predicted 1393
10 SASI_Mm02_00308569 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087938 predicted 1173
2 SASI_Mm01_00087939 predicted 1143
3 SASI_Mm01_00087941 predicted 696
4 SASI_Mm01_00087942 predicted 618
5 SASI_Mm01_00087943 predicted 1188
6 SASI_Mm01_00087945 predicted 744
7 SASI_Mm01_00087946 predicted 1103
8 SASI_Mm02_00327360 predicted 448
9 SASI_Mm01_00087947 predicted 697
10 SASI_Mm02_00327361 predicted 669
11 SASI_Mm01_00087940 predicted 1125
12 SASI_Mm01_00087944 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138316
VALIDATED
PANK1 MISSION shRNA Bacterial Glycerol Stock
pantothenate kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138316.2-300s21c1
Sequence:CCGGTGAAGAGCATCCGGAAGTATTCTCGAGAATACTTCCGGATGCTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-600s1c1
Sequence:CCGGGCCTGCTTTATGTCGACTCTGCTCGAGCAGAGTCGACATAAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-912s1c1
Sequence:CCGGGCGCGTTGAATGAGAACATAGCTCGAGCTATGTTCTCATTCAACGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-311s1c1
Sequence:CCGGCGGAAGTATTTGACTTCTAATCTCGAGATTAGAAGTCAAATACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-1873s1c1
Sequence:CCGGGTTTGTCCTATCGCTTATAAACTCGAGTTTATAAGCGATAGGACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-437s1c1
Sequence:CCGGGCTATGCACAGGTTCATTCAGCTCGAGCTGAATGAACCTGTGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138316.2-1490s21c1
Sequence:CCGGAGTAATTACTCTAGGAGATTTCTCGAGAAATCTCCTAGAGTAATTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138316.2-1704s1c1
Sequence:CCGGCCCTACCTGTAACCTTTCTTTCTCGAGAAAGAAAGGTTACAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-228s1c1
Sequence:CCGGCGCTGGTTAAATTGGTGTATTCTCGAGAATACACCAATTTAACCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-254s1c1
Sequence:CCGGCCGAAGGATATTACAGCCGAACTCGAGTTCGGCTGTAATATCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-988s1c1
Sequence:CCGGGCTGGCATATGCCATGGATTTCTCGAGAAATCCATGGCATATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-699s1c1
Sequence:CCGGGCCTTGATAACCCATACCCTACTCGAGTAGGGTATGGGTTATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-716s1c1
Sequence:CCGGCCTATGTTGCTGGTTAACATGCTCGAGCATGTTAACCAGCAACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138316
VALIDATED
PANK1 MISSION shRNA shRNA Plasmid DNA
pantothenate kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138316.2-300s21c1
Sequence:CCGGTGAAGAGCATCCGGAAGTATTCTCGAGAATACTTCCGGATGCTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-600s1c1
Sequence:CCGGGCCTGCTTTATGTCGACTCTGCTCGAGCAGAGTCGACATAAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-912s1c1
Sequence:CCGGGCGCGTTGAATGAGAACATAGCTCGAGCTATGTTCTCATTCAACGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-311s1c1
Sequence:CCGGCGGAAGTATTTGACTTCTAATCTCGAGATTAGAAGTCAAATACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-1873s1c1
Sequence:CCGGGTTTGTCCTATCGCTTATAAACTCGAGTTTATAAGCGATAGGACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-437s1c1
Sequence:CCGGGCTATGCACAGGTTCATTCAGCTCGAGCTGAATGAACCTGTGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138316.2-1490s21c1
Sequence:CCGGAGTAATTACTCTAGGAGATTTCTCGAGAAATCTCCTAGAGTAATTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138316.2-1704s1c1
Sequence:CCGGCCCTACCTGTAACCTTTCTTTCTCGAGAAAGAAAGGTTACAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-228s1c1
Sequence:CCGGCGCTGGTTAAATTGGTGTATTCTCGAGAATACACCAATTTAACCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-254s1c1
Sequence:CCGGCCGAAGGATATTACAGCCGAACTCGAGTTCGGCTGTAATATCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-988s1c1
Sequence:CCGGGCTGGCATATGCCATGGATTTCTCGAGAAATCCATGGCATATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-699s1c1
Sequence:CCGGGCCTTGATAACCCATACCCTACTCGAGTAGGGTATGGGTTATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-716s1c1
Sequence:CCGGCCTATGTTGCTGGTTAACATGCTCGAGCATGTTAACCAGCAACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138316
VALIDATED
PANK1 MISSION shRNA Lentiviral Transduction Particles
pantothenate kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138316.2-300s21c1
Sequence:CCGGTGAAGAGCATCCGGAAGTATTCTCGAGAATACTTCCGGATGCTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-600s1c1
Sequence:CCGGGCCTGCTTTATGTCGACTCTGCTCGAGCAGAGTCGACATAAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-912s1c1
Sequence:CCGGGCGCGTTGAATGAGAACATAGCTCGAGCTATGTTCTCATTCAACGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-311s1c1
Sequence:CCGGCGGAAGTATTTGACTTCTAATCTCGAGATTAGAAGTCAAATACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-1873s1c1
Sequence:CCGGGTTTGTCCTATCGCTTATAAACTCGAGTTTATAAGCGATAGGACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-437s1c1
Sequence:CCGGGCTATGCACAGGTTCATTCAGCTCGAGCTGAATGAACCTGTGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138316.2-1490s21c1
Sequence:CCGGAGTAATTACTCTAGGAGATTTCTCGAGAAATCTCCTAGAGTAATTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138316.2-1704s1c1
Sequence:CCGGCCCTACCTGTAACCTTTCTTTCTCGAGAAAGAAAGGTTACAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-228s1c1
Sequence:CCGGCGCTGGTTAAATTGGTGTATTCTCGAGAATACACCAATTTAACCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-254s1c1
Sequence:CCGGCCGAAGGATATTACAGCCGAACTCGAGTTCGGCTGTAATATCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138316.2-988s1c1
Sequence:CCGGGCTGGCATATGCCATGGATTTCTCGAGAAATCCATGGCATATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-699s1c1
Sequence:CCGGGCCTTGATAACCCATACCCTACTCGAGTAGGGTATGGGTTATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138316.2-716s1c1
Sequence:CCGGCCTATGTTGCTGGTTAACATGCTCGAGCATGTTAACCAGCAACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023792
VALIDATED
PANK1 MISSION shRNA Bacterial Glycerol Stock
pantothenate kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1663s21c1
Sequence:CCGGTACTGATCAGTGTGGTAATTTCTCGAGAAATTACCACACTGATCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1254s21c1
Sequence:CCGGTTTGGAACATGAGGGTTATTTCTCGAGAAATAACCCTCATGTTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1462s21c1
Sequence:CCGGGCTCTTAGCTTTCAAGCTTATCTCGAGATAAGCTTGAAAGCTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-944s21c1
Sequence:CCGGATAAGCTGGTGAAGGACATTTCTCGAGAAATGTCCTTCACCAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-348s1c1
Sequence:CCGGCCGGAAGTATTTAACTTCTAACTCGAGTTAGAAGTTAAATACTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1022s1c1
Sequence:CCGGGCAACATGATGAGCAAAGAAACTCGAGTTTCTTTGCTCATCATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023792.1-750s1c1
Sequence:CCGGGTACCCTATGTTGCTGGTTAACTCGAGTTAACCAGCAACATAGGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-237s1c1
Sequence:CCGGCCCGTGGTTTGGTATGGATATCTCGAGATATCCATACCAAACCACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1176s1c1
Sequence:CCGGCAGAATCAATATGGTCTCAATCTCGAGATTGAGACCATATTGATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1192s21c1
Sequence:CCGGTCAATGAAGTTGCTAGCATATCTCGAGATATGCTAGCAACTTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023792
VALIDATED
PANK1 MISSION shRNA shRNA Plasmid DNA
pantothenate kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1663s21c1
Sequence:CCGGTACTGATCAGTGTGGTAATTTCTCGAGAAATTACCACACTGATCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1254s21c1
Sequence:CCGGTTTGGAACATGAGGGTTATTTCTCGAGAAATAACCCTCATGTTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1462s21c1
Sequence:CCGGGCTCTTAGCTTTCAAGCTTATCTCGAGATAAGCTTGAAAGCTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-944s21c1
Sequence:CCGGATAAGCTGGTGAAGGACATTTCTCGAGAAATGTCCTTCACCAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-348s1c1
Sequence:CCGGCCGGAAGTATTTAACTTCTAACTCGAGTTAGAAGTTAAATACTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1022s1c1
Sequence:CCGGGCAACATGATGAGCAAAGAAACTCGAGTTTCTTTGCTCATCATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023792.1-750s1c1
Sequence:CCGGGTACCCTATGTTGCTGGTTAACTCGAGTTAACCAGCAACATAGGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-237s1c1
Sequence:CCGGCCCGTGGTTTGGTATGGATATCTCGAGATATCCATACCAAACCACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1176s1c1
Sequence:CCGGCAGAATCAATATGGTCTCAATCTCGAGATTGAGACCATATTGATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1192s21c1
Sequence:CCGGTCAATGAAGTTGCTAGCATATCTCGAGATATGCTAGCAACTTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023792
VALIDATED
PANK1 MISSION shRNA Lentiviral Transduction Particles
pantothenate kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1663s21c1
Sequence:CCGGTACTGATCAGTGTGGTAATTTCTCGAGAAATTACCACACTGATCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1254s21c1
Sequence:CCGGTTTGGAACATGAGGGTTATTTCTCGAGAAATAACCCTCATGTTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1462s21c1
Sequence:CCGGGCTCTTAGCTTTCAAGCTTATCTCGAGATAAGCTTGAAAGCTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-944s21c1
Sequence:CCGGATAAGCTGGTGAAGGACATTTCTCGAGAAATGTCCTTCACCAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-348s1c1
Sequence:CCGGCCGGAAGTATTTAACTTCTAACTCGAGTTAGAAGTTAAATACTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1022s1c1
Sequence:CCGGGCAACATGATGAGCAAAGAAACTCGAGTTTCTTTGCTCATCATGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023792.1-750s1c1
Sequence:CCGGGTACCCTATGTTGCTGGTTAACTCGAGTTAACCAGCAACATAGGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-237s1c1
Sequence:CCGGCCCGTGGTTTGGTATGGATATCTCGAGATATCCATACCAAACCACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023792.1-1176s1c1
Sequence:CCGGCAGAATCAATATGGTCTCAATCTCGAGATTGAGACCATATTGATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023792.1-1192s21c1
Sequence:CCGGTCAATGAAGTTGCTAGCATATCTCGAGATATGCTAGCAACTTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)