EMAIL THIS PAGE TO A FRIEND

PANK4

pantothenate kinase 4

61 Gene Product Result for
UniProtKB ID: Q9NVE7, B9DI84, Q53EU3, Q5TA84, Q7RTX3, Q9H3X5
Gene ID:
Human(55229) Summary: This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
Mouse(269614) pantothenate kinase 4
Rat(171053) pantothenate kinase 4
Zebrafish(393487) pantothenate kinase 4
domestic cat(101089373) pantothenate kinase 4
dog(479579) pantothenate kinase 4
cow(514589) pantothenate kinase 4
chicken(100736561) pantothenate kinase 4
sheep(101103660) pantothenate kinase 4
naked mole-rat(101724756) pantothenate kinase 4
domestic guinea pig(100725421) pantothenate kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018216 Rosetta Predictions human pricing
NM_133531 Rosetta Predictions rat pricing
NM_172990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351524 predicted 854
2 SASI_Hs01_00069282 predicted 385
3 SASI_Hs01_00069283 predicted 2287
4 SASI_Hs01_00069284 predicted 1586
5 SASI_Hs01_00069285 predicted 1719
6 SASI_Hs01_00069287 predicted 1876
7 SASI_Hs02_00351525 predicted 2190
8 SASI_Hs01_00069288 predicted 233
9 SASI_Hs01_00069289 predicted 1566
10 SASI_Hs01_00069290 predicted 223
11 SASI_Hs01_00069286 predicted 1945
12 SASI_Hs01_00069291 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076993 predicted 1993
2 SASI_Rn01_00076994 predicted 1680
3 SASI_Rn01_00076995 predicted 489
4 SASI_Rn01_00076996 predicted 1861
5 SASI_Rn01_00076997 predicted 434
6 SASI_Rn01_00076999 predicted 1537
7 SASI_Rn01_00077001 predicted 236
8 SASI_Rn01_00077002 predicted 374
9 SASI_Rn02_00267711 predicted 1293
10 SASI_Rn02_00267712 predicted 926
11 SASI_Rn01_00076998 predicted 1848
12 SASI_Rn01_00077000 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164231 predicted 1999
2 SASI_Mm01_00164232 predicted 1685
3 SASI_Mm01_00164233 predicted 1911
4 SASI_Mm01_00164234 predicted 1223
5 SASI_Mm01_00164235 predicted 1950
6 SASI_Mm01_00164236 predicted 390
7 SASI_Mm01_00164237 predicted 1314
8 SASI_Mm01_00164238 predicted 1439
9 SASI_Mm01_00164239 predicted 1537
10 SASI_Mm01_00164240 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018216
VALIDATED
PANK4 MISSION shRNA Bacterial Glycerol Stock
pantothenate kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-1119s1c1
Sequence:CCGGGCAGGACAATCCTAACCAGTACTCGAGTACTGGTTAGGATTGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-572s1c1
Sequence:CCGGCCTATCTTCTTGTCAATATCGCTCGAGCGATATTGACAAGAAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018216.1-869s1c1
Sequence:CCGGCCAAAGAAGACATGGCGAAGACTCGAGTCTTCGCCATGTCTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-238s1c1
Sequence:CCGGCCGCCCTATGAGATTTCAGTTCTCGAGAACTGAAATCTCATAGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018216.1-277s1c1
Sequence:CCGGCGACTGCACTTCATTAAGTTTCTCGAGAAACTTAATGAAGTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-897s1c1
Sequence:CCGGGCACATGATCAGCAACGACATCTCGAGATGTCGTTGCTGATCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-448s21c1
Sequence:CCGGGTGATGACGTGCCTGATTAAGCTCGAGCTTAATCAGGCACGTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2401s1c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2347s1c1
Sequence:CCGGGGACTCTTCTGCTTGTCACTTCTCGAGAAGTGACAAGCAGAAGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018216.1-2401s21c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018216.1-2006s21c1
Sequence:CCGGTCATCGTGGCAGAGCGTATTGCTCGAGCAATACGCTCTGCCACGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-1005s21c1
Sequence:CCGGCATGCGCACCATCACCTATAGCTCGAGCTATAGGTGATGGTGCGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-125s21c1
Sequence:CCGGTCGACATAGGCGGGTCGTTAACTCGAGTTAACGACCCGCCTATGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018216
VALIDATED
PANK4 MISSION shRNA shRNA Plasmid DNA
pantothenate kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-1119s1c1
Sequence:CCGGGCAGGACAATCCTAACCAGTACTCGAGTACTGGTTAGGATTGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-572s1c1
Sequence:CCGGCCTATCTTCTTGTCAATATCGCTCGAGCGATATTGACAAGAAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018216.1-869s1c1
Sequence:CCGGCCAAAGAAGACATGGCGAAGACTCGAGTCTTCGCCATGTCTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-238s1c1
Sequence:CCGGCCGCCCTATGAGATTTCAGTTCTCGAGAACTGAAATCTCATAGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018216.1-277s1c1
Sequence:CCGGCGACTGCACTTCATTAAGTTTCTCGAGAAACTTAATGAAGTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-897s1c1
Sequence:CCGGGCACATGATCAGCAACGACATCTCGAGATGTCGTTGCTGATCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-448s21c1
Sequence:CCGGGTGATGACGTGCCTGATTAAGCTCGAGCTTAATCAGGCACGTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2401s1c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2347s1c1
Sequence:CCGGGGACTCTTCTGCTTGTCACTTCTCGAGAAGTGACAAGCAGAAGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018216.1-2401s21c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018216.1-2006s21c1
Sequence:CCGGTCATCGTGGCAGAGCGTATTGCTCGAGCAATACGCTCTGCCACGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-1005s21c1
Sequence:CCGGCATGCGCACCATCACCTATAGCTCGAGCTATAGGTGATGGTGCGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-125s21c1
Sequence:CCGGTCGACATAGGCGGGTCGTTAACTCGAGTTAACGACCCGCCTATGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018216
VALIDATED
PANK4 MISSION shRNA Lentiviral Transduction Particles
pantothenate kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-1119s1c1
Sequence:CCGGGCAGGACAATCCTAACCAGTACTCGAGTACTGGTTAGGATTGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018216.1-572s1c1
Sequence:CCGGCCTATCTTCTTGTCAATATCGCTCGAGCGATATTGACAAGAAGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018216.1-869s1c1
Sequence:CCGGCCAAAGAAGACATGGCGAAGACTCGAGTCTTCGCCATGTCTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-238s1c1
Sequence:CCGGCCGCCCTATGAGATTTCAGTTCTCGAGAACTGAAATCTCATAGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018216.1-277s1c1
Sequence:CCGGCGACTGCACTTCATTAAGTTTCTCGAGAAACTTAATGAAGTGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018216.1-897s1c1
Sequence:CCGGGCACATGATCAGCAACGACATCTCGAGATGTCGTTGCTGATCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-448s21c1
Sequence:CCGGGTGATGACGTGCCTGATTAAGCTCGAGCTTAATCAGGCACGTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2401s1c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018216.1-2347s1c1
Sequence:CCGGGGACTCTTCTGCTTGTCACTTCTCGAGAAGTGACAAGCAGAAGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018216.1-2401s21c1
Sequence:CCGGTGCGTTCAAATCAACGTATTTCTCGAGAAATACGTTGATTTGAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018216.1-2006s21c1
Sequence:CCGGTCATCGTGGCAGAGCGTATTGCTCGAGCAATACGCTCTGCCACGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-1005s21c1
Sequence:CCGGCATGCGCACCATCACCTATAGCTCGAGCTATAGGTGATGGTGCGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018216.1-125s21c1
Sequence:CCGGTCGACATAGGCGGGTCGTTAACTCGAGTTAACGACCCGCCTATGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172990
PANK4 MISSION shRNA Bacterial Glycerol Stock
pantothenate kinase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1854s1c1
Sequence:CCGGCCCTCATAAATGTGCCTTAATCTCGAGATTAAGGCACATTTATGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-577s1c1
Sequence:CCGGCCCTACCTCCTAGTCAACATTCTCGAGAATGTTGACTAGGAGGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1015s1c1
Sequence:CCGGCGCACAATCACCTACAGCATTCTCGAGAATGCTGTAGGTGATTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-283s1c1
Sequence:CCGGCGCCTGCATTTCATCAAGTTTCTCGAGAAACTTGATGAAATGCAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-128s1c1
Sequence:CCGGCCATTGATATAGGTGGATCATCTCGAGATGATCCACCTATATCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-147s21c1
Sequence:CCGGTGACCAAGTTGGCATACTATTCTCGAGAATAGTATGCCAACTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-576s21c1
Sequence:CCGGCCTACCTCCTAGTCAACATTGCTCGAGCAATGTTGACTAGGAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172990.4-2400s21c1
Sequence:CCGGCTGTGTTCACACCGGAGTATTCTCGAGAATACTCCGGTGTGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172990
PANK4 MISSION shRNA shRNA Plasmid DNA
pantothenate kinase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1854s1c1
Sequence:CCGGCCCTCATAAATGTGCCTTAATCTCGAGATTAAGGCACATTTATGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-577s1c1
Sequence:CCGGCCCTACCTCCTAGTCAACATTCTCGAGAATGTTGACTAGGAGGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1015s1c1
Sequence:CCGGCGCACAATCACCTACAGCATTCTCGAGAATGCTGTAGGTGATTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-283s1c1
Sequence:CCGGCGCCTGCATTTCATCAAGTTTCTCGAGAAACTTGATGAAATGCAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-128s1c1
Sequence:CCGGCCATTGATATAGGTGGATCATCTCGAGATGATCCACCTATATCAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-147s21c1
Sequence:CCGGTGACCAAGTTGGCATACTATTCTCGAGAATAGTATGCCAACTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-576s21c1
Sequence:CCGGCCTACCTCCTAGTCAACATTGCTCGAGCAATGTTGACTAGGAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172990.4-2400s21c1
Sequence:CCGGCTGTGTTCACACCGGAGTATTCTCGAGAATACTCCGGTGTGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172990
PANK4 MISSION shRNA Lentiviral Transduction Particles
pantothenate kinase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1854s1c1
Sequence:CCGGCCCTCATAAATGTGCCTTAATCTCGAGATTAAGGCACATTTATGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-577s1c1
Sequence:CCGGCCCTACCTCCTAGTCAACATTCTCGAGAATGTTGACTAGGAGGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-1015s1c1
Sequence:CCGGCGCACAATCACCTACAGCATTCTCGAGAATGCTGTAGGTGATTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-283s1c1
Sequence:CCGGCGCCTGCATTTCATCAAGTTTCTCGAGAAACTTGATGAAATGCAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172990.1-128s1c1
Sequence:CCGGCCATTGATATAGGTGGATCATCTCGAGATGATCCACCTATATCAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-147s21c1
Sequence:CCGGTGACCAAGTTGGCATACTATTCTCGAGAATAGTATGCCAACTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172990.4-576s21c1
Sequence:CCGGCCTACCTCCTAGTCAACATTGCTCGAGCAATGTTGACTAGGAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172990.4-2400s21c1
Sequence:CCGGCTGTGTTCACACCGGAGTATTCTCGAGAATACTCCGGTGTGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)