EMAIL THIS PAGE TO A FRIEND

PANX2

pannexin 2

87 Gene Product Result for
Synonyms: PX2 hPANX2
UniProtKB ID: Q96RD6, B7Z684, Q96RD5, Q9UGX8
Gene ID:
Human(56666) Summary: The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 1 are abundantly expressed in central nervous system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 1 may form cell type-specific gap junctions with distinct properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(406218) pannexin 2
Rat(362979) pannexin 2
Zebrafish(557828) pannexin 2
chicken(426934) pannexin 2
dog(481195) pannexin 2
cow(539070) pannexin 2
sheep(101114697) pannexin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108014 Anti-PANX2 antibody produced in rabbit IgG fraction of antiserum rat, human, guinea pig, horse, mouse, dog, bovine
immunohistochemistry, western blot pricing
AV42778 Anti-PANX2 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder zebrafish, horse, canine, rabbit, mouse, rat, chicken, human
immunohistochemistry, western blot pricing
HPA039117 Anti-PANX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB5200735 Monoclonal Anti-Pannexin - Alkaline Phosphatase antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200736 Monoclonal Anti-Pannexin - Apc antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200727 Monoclonal Anti-Pannexin - Atto 390 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200728 Monoclonal Anti-Pannexin - Atto 488 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200729 Monoclonal Anti-Pannexin - Atto 565 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200730 Monoclonal Anti-Pannexin - Atto 594 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200731 Monoclonal Anti-Pannexin - Atto 633 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200732 Monoclonal Anti-Pannexin - Atto 655 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200733 Monoclonal Anti-Pannexin - Atto 680 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200734 Monoclonal Anti-Pannexin - Atto 700 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200737 Monoclonal Anti-Pannexin - Biotin antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200738 Monoclonal Anti-Pannexin - Fitc antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200739 Monoclonal Anti-Pannexin - Hrp antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200740 Monoclonal Anti-Pannexin - Pe/Atto 594 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200741 Monoclonal Anti-Pannexin - Percp antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200742 Monoclonal Anti-Pannexin - Rpe antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200743 Monoclonal Anti-Pannexin - Streptavidin antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB5200726 Monoclonal Anti-Pannexin-2 antibody produced in mouse clone S121A-31, purified immunoglobulin rat
immunohistochemistry, western blot pricing
SAB1412857 Monoclonal Anti-PANX2 antibody produced in mouse clone 2B11, purified immunoglobulin human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052839 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU049541 MISSION® esiRNA esiRNA targeting mouse Panx2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052839 Rosetta Predictions human pricing
NM_199409 Rosetta Predictions rat pricing
XM_579735 Rosetta Predictions rat pricing
NM_001002005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060454 predicted 568
2 SASI_Hs01_00060455 predicted 1072
3 SASI_Hs01_00060456 predicted 743
4 SASI_Hs02_00361519 predicted 215
5 SASI_Hs01_00060457 predicted 929
6 SASI_Hs01_00060458 predicted 2004
7 SASI_Hs01_00060459 predicted 1091
8 SASI_Hs01_00060460 predicted 547
9 SASI_Hs01_00060461 predicted 1837
10 SASI_Hs01_00060462 predicted 735
11 SASI_Hs01_00060463 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095047 predicted 556
2 SASI_Rn01_00095049 predicted 1203
3 SASI_Rn01_00095050 predicted 1401
4 SASI_Rn01_00095051 predicted 548
5 SASI_Rn01_00095053 predicted 1009
6 SASI_Rn01_00095054 predicted 1184
7 SASI_Rn01_00095055 predicted 2020
8 SASI_Rn01_00095056 predicted 2200
9 SASI_Rn02_00270239 predicted 1878
10 SASI_Rn02_00270240 predicted 532
11 SASI_Rn01_00095048 predicted 1896
12 SASI_Rn01_00095052 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176052 predicted 1585
2 SASI_Rn01_00176053 predicted 903
3 SASI_Rn01_00176054 predicted 1098
4 SASI_Rn01_00176055 predicted 1109
5 SASI_Rn01_00176056 predicted 704
6 SASI_Rn01_00176057 predicted 616
7 SASI_Rn01_00176058 predicted 880
8 SASI_Rn01_00176059 predicted 1721
9 SASI_Rn01_00176060 predicted 1892
10 SASI_Rn01_00176061 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286264 predicted 1298
2 SASI_Mm01_00115240 predicted 1298
3 SASI_Mm02_00286265 predicted 573
4 SASI_Mm02_00286266 predicted 580
5 SASI_Mm02_00286267 predicted 694
6 SASI_Mm01_00115243 predicted 1900
7 SASI_Mm02_00286268 predicted 2228
8 SASI_Mm01_00115246 predicted 1911
9 SASI_Mm02_00286269 predicted 1470
10 SASI_Mm02_00286270 predicted 556
11 SASI_Mm01_00115238 predicted 717
12 SASI_Mm01_00115239 predicted 1048
13 SASI_Mm01_00115241 predicted 311
14 SASI_Mm01_00115242 predicted 527
15 SASI_Mm01_00115244 predicted 856
16 SASI_Mm01_00115245 predicted 1513
17 SASI_Mm01_00115247 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002005
PANX2 MISSION shRNA Bacterial Glycerol Stock
pannexin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-1516s1c1
Sequence:CCGGGACGTGCATCCCTATATCCTACTCGAGTAGGATATAGGGATGCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-543s1c1
Sequence:CCGGGAAGCGAGAGATCATTGAGAACTCGAGTTCTCAATGATCTCTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-588s1c1
Sequence:CCGGGCAGAATCTGTTTGAGAAGTACTCGAGTACTTCTCAAACAGATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-196s1c1
Sequence:CCGGGAGGAACCAATTTACTGTTATCTCGAGATAACAGTAAATTGGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-942s1c1
Sequence:CCGGCAAACTAAACAAGGTGGGTATCTCGAGATACCCACCTTGTTTAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002005
PANX2 MISSION shRNA shRNA Plasmid DNA
pannexin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-1516s1c1
Sequence:CCGGGACGTGCATCCCTATATCCTACTCGAGTAGGATATAGGGATGCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-543s1c1
Sequence:CCGGGAAGCGAGAGATCATTGAGAACTCGAGTTCTCAATGATCTCTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-588s1c1
Sequence:CCGGGCAGAATCTGTTTGAGAAGTACTCGAGTACTTCTCAAACAGATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-196s1c1
Sequence:CCGGGAGGAACCAATTTACTGTTATCTCGAGATAACAGTAAATTGGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-942s1c1
Sequence:CCGGCAAACTAAACAAGGTGGGTATCTCGAGATACCCACCTTGTTTAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002005
PANX2 MISSION shRNA Lentiviral Transduction Particles
pannexin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-1516s1c1
Sequence:CCGGGACGTGCATCCCTATATCCTACTCGAGTAGGATATAGGGATGCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-543s1c1
Sequence:CCGGGAAGCGAGAGATCATTGAGAACTCGAGTTCTCAATGATCTCTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-588s1c1
Sequence:CCGGGCAGAATCTGTTTGAGAAGTACTCGAGTACTTCTCAAACAGATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-196s1c1
Sequence:CCGGGAGGAACCAATTTACTGTTATCTCGAGATAACAGTAAATTGGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002005.1-942s1c1
Sequence:CCGGCAAACTAAACAAGGTGGGTATCTCGAGATACCCACCTTGTTTAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052839
PANX2 MISSION shRNA Bacterial Glycerol Stock
pannexin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-189s1c1
Sequence:CCGGCTTCGCAGAGGAACCCATTTACTCGAGTAAATGGGTTCCTCTGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2223s1c1
Sequence:CCGGCCTGAGGTGAAGAGTTTATTTCTCGAGAAATAAACTCTTCACCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-1248s1c1
Sequence:CCGGGCGCAAGAAGATGAAGTGGATCTCGAGATCCACTTCATCTTCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-193s1c1
Sequence:CCGGGCAGAGGAACCCATTTACTGTCTCGAGACAGTAAATGGGTTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-864s1c1
Sequence:CCGGGTGCGTCATGAACCTCATCATCTCGAGATGATGAGGTTCATGACGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-987s1c1
Sequence:CCGGGCAGTTCTGCGACATCAACATCTCGAGATGTTGATGTCGCAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-444s1c1
Sequence:CCGGGCAGGAGATCGACAACTGTTACTCGAGTAACAGTTGTCGATCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-906s1c1
Sequence:CCGGCTTCATCTTCCGCAAGAGCAACTCGAGTTGCTCTTGCGGAAGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-912s1c1
Sequence:CCGGCTTCCGCAAGAGCAACTTCATCTCGAGATGAAGTTGCTCTTGCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2221s1c1
Sequence:CCGGGCCCTGAGGTGAAGAGTTTATCTCGAGATAAACTCTTCACCTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052839
PANX2 MISSION shRNA shRNA Plasmid DNA
pannexin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-189s1c1
Sequence:CCGGCTTCGCAGAGGAACCCATTTACTCGAGTAAATGGGTTCCTCTGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2223s1c1
Sequence:CCGGCCTGAGGTGAAGAGTTTATTTCTCGAGAAATAAACTCTTCACCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-1248s1c1
Sequence:CCGGGCGCAAGAAGATGAAGTGGATCTCGAGATCCACTTCATCTTCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-193s1c1
Sequence:CCGGGCAGAGGAACCCATTTACTGTCTCGAGACAGTAAATGGGTTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-864s1c1
Sequence:CCGGGTGCGTCATGAACCTCATCATCTCGAGATGATGAGGTTCATGACGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-987s1c1
Sequence:CCGGGCAGTTCTGCGACATCAACATCTCGAGATGTTGATGTCGCAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-444s1c1
Sequence:CCGGGCAGGAGATCGACAACTGTTACTCGAGTAACAGTTGTCGATCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-906s1c1
Sequence:CCGGCTTCATCTTCCGCAAGAGCAACTCGAGTTGCTCTTGCGGAAGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-912s1c1
Sequence:CCGGCTTCCGCAAGAGCAACTTCATCTCGAGATGAAGTTGCTCTTGCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2221s1c1
Sequence:CCGGGCCCTGAGGTGAAGAGTTTATCTCGAGATAAACTCTTCACCTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052839
PANX2 MISSION shRNA Lentiviral Transduction Particles
pannexin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-189s1c1
Sequence:CCGGCTTCGCAGAGGAACCCATTTACTCGAGTAAATGGGTTCCTCTGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2223s1c1
Sequence:CCGGCCTGAGGTGAAGAGTTTATTTCTCGAGAAATAAACTCTTCACCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-1248s1c1
Sequence:CCGGGCGCAAGAAGATGAAGTGGATCTCGAGATCCACTTCATCTTCTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-193s1c1
Sequence:CCGGGCAGAGGAACCCATTTACTGTCTCGAGACAGTAAATGGGTTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-864s1c1
Sequence:CCGGGTGCGTCATGAACCTCATCATCTCGAGATGATGAGGTTCATGACGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-987s1c1
Sequence:CCGGGCAGTTCTGCGACATCAACATCTCGAGATGTTGATGTCGCAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-444s1c1
Sequence:CCGGGCAGGAGATCGACAACTGTTACTCGAGTAACAGTTGTCGATCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-906s1c1
Sequence:CCGGCTTCATCTTCCGCAAGAGCAACTCGAGTTGCTCTTGCGGAAGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052839.2-912s1c1
Sequence:CCGGCTTCCGCAAGAGCAACTTCATCTCGAGATGAAGTTGCTCTTGCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052839.2-2221s1c1
Sequence:CCGGGCCCTGAGGTGAAGAGTTTATCTCGAGATAAACTCTTCACCTCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)