EMAIL THIS PAGE TO A FRIEND

PANX3

pannexin 3

53 Gene Product Result for
Synonyms: PX3
UniProtKB ID: Q96QZ0
Gene ID:
Human(116337) Summary: The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
Mouse(208098) pannexin 3
Rat(315567) pannexin 3
sheep(101106978) pannexin 3
chicken(768736) pannexin 3
cow(538977) pannexin 3
dog(609899) pannexin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304255 ANTI-PANX3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2104727 Anti-PANX3 antibody produced in rabbit affinity isolated antibody horse, human, dog, guinea pig, rat, mouse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052959 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028541 MISSION® esiRNA esiRNA human PANX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052959 Rosetta Predictions human pricing
NM_199398 Rosetta Predictions rat pricing
NM_172454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065190 predicted 1161
2 SASI_Hs01_00065191 predicted 1159
3 SASI_Hs01_00065192 predicted 1195
4 SASI_Hs01_00065193 predicted 765
5 SASI_Hs01_00065194 predicted 1036
6 SASI_Hs01_00065195 predicted 809
7 SASI_Hs01_00065196 predicted 780
8 SASI_Hs01_00065197 predicted 1070
9 SASI_Hs01_00065198 predicted 679
10 SASI_Hs01_00065199 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270222 predicted 860
2 SASI_Rn01_00032244 predicted 1012
3 SASI_Rn01_00032245 predicted 1721
4 SASI_Rn01_00032246 predicted 1709
5 SASI_Rn01_00032248 predicted 1112
6 SASI_Rn01_00032249 predicted 1702
7 SASI_Rn01_00032250 predicted 324
8 SASI_Rn01_00032252 predicted 1752
9 SASI_Rn02_00270223 predicted 987
10 SASI_Rn01_00032253 predicted 418
11 SASI_Rn01_00032247 predicted 1768
12 SASI_Rn01_00032251 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343972 predicted 1326
2 SASI_Mm01_00156181 predicted 536
3 SASI_Mm01_00156182 predicted 1022
4 SASI_Mm01_00156183 predicted 1062
5 SASI_Mm01_00156184 predicted 1310
6 SASI_Mm01_00156186 predicted 523
7 SASI_Mm01_00156187 predicted 1162
8 SASI_Mm01_00156188 predicted 849
9 SASI_Mm01_00156189 predicted 1206
10 SASI_Mm01_00156190 predicted 1270
11 SASI_Mm01_00156185 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172454
PANX3 MISSION shRNA Bacterial Glycerol Stock
pannexin 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1011s21c1
Sequence:CCGGATATTGGTCCCAGTGATAATACTCGAGTATTATCACTGGGACCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172454.2-2091s21c1
Sequence:CCGGCCAAGCCTGAATACCTGATTTCTCGAGAAATCAGGTATTCAGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-667s1c1
Sequence:CCGGCGGAAGGAACGGTACTTTGAACTCGAGTTCAAAGTACCGTTCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-837s1c1
Sequence:CCGGCGAATTTAACTGCTTCATCAACTCGAGTTGATGAAGCAGTTAAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-501s1c1
Sequence:CCGGGCTGTGGCAATATGTAGCTGTCTCGAGACAGCTACATATTGCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-868s21c1
Sequence:CCGGTCTTCTTTCAAGACGAATTTACTCGAGTAAATTCGTCTTGAAAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-805s21c1
Sequence:CCGGACGCCCTCTTACTCCTCTTTACTCGAGTAAAGAGGAGTAAGAGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1330s21c1
Sequence:CCGGATGATGAACACGCATAGTTTACTCGAGTAAACTATGCGTGTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172454
PANX3 MISSION shRNA shRNA Plasmid DNA
pannexin 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1011s21c1
Sequence:CCGGATATTGGTCCCAGTGATAATACTCGAGTATTATCACTGGGACCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172454.2-2091s21c1
Sequence:CCGGCCAAGCCTGAATACCTGATTTCTCGAGAAATCAGGTATTCAGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-667s1c1
Sequence:CCGGCGGAAGGAACGGTACTTTGAACTCGAGTTCAAAGTACCGTTCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-837s1c1
Sequence:CCGGCGAATTTAACTGCTTCATCAACTCGAGTTGATGAAGCAGTTAAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-501s1c1
Sequence:CCGGGCTGTGGCAATATGTAGCTGTCTCGAGACAGCTACATATTGCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-868s21c1
Sequence:CCGGTCTTCTTTCAAGACGAATTTACTCGAGTAAATTCGTCTTGAAAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-805s21c1
Sequence:CCGGACGCCCTCTTACTCCTCTTTACTCGAGTAAAGAGGAGTAAGAGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1330s21c1
Sequence:CCGGATGATGAACACGCATAGTTTACTCGAGTAAACTATGCGTGTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172454
PANX3 MISSION shRNA Lentiviral Transduction Particles
pannexin 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1011s21c1
Sequence:CCGGATATTGGTCCCAGTGATAATACTCGAGTATTATCACTGGGACCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172454.2-2091s21c1
Sequence:CCGGCCAAGCCTGAATACCTGATTTCTCGAGAAATCAGGTATTCAGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-667s1c1
Sequence:CCGGCGGAAGGAACGGTACTTTGAACTCGAGTTCAAAGTACCGTTCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-837s1c1
Sequence:CCGGCGAATTTAACTGCTTCATCAACTCGAGTTGATGAAGCAGTTAAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172454.1-501s1c1
Sequence:CCGGGCTGTGGCAATATGTAGCTGTCTCGAGACAGCTACATATTGCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-868s21c1
Sequence:CCGGTCTTCTTTCAAGACGAATTTACTCGAGTAAATTCGTCTTGAAAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-805s21c1
Sequence:CCGGACGCCCTCTTACTCCTCTTTACTCGAGTAAAGAGGAGTAAGAGGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172454.2-1330s21c1
Sequence:CCGGATGATGAACACGCATAGTTTACTCGAGTAAACTATGCGTGTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052959
PANX3 MISSION shRNA Bacterial Glycerol Stock
pannexin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-742s1c1
Sequence:CCGGCTGCTAAGTGATGAGACCCATCTCGAGATGGGTCTCATCACTTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-842s1c1
Sequence:CCGGCCATATTGGTTCCAGTGATAACTCGAGTTATCACTGGAACCAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052959.2-1339s1c1
Sequence:CCGGGAGAAGACATAACCAAGACATCTCGAGATGTCTTGGTTATGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-541s1c1
Sequence:CCGGGCTCGGAAAGAACGATACTTTCTCGAGAAAGTATCGTTCTTTCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-1038s1c1
Sequence:CCGGGAGTGTCTTATGTGTGTTGAACTCGAGTTCAACACACATAAGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052959
PANX3 MISSION shRNA shRNA Plasmid DNA
pannexin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-742s1c1
Sequence:CCGGCTGCTAAGTGATGAGACCCATCTCGAGATGGGTCTCATCACTTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-842s1c1
Sequence:CCGGCCATATTGGTTCCAGTGATAACTCGAGTTATCACTGGAACCAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052959.2-1339s1c1
Sequence:CCGGGAGAAGACATAACCAAGACATCTCGAGATGTCTTGGTTATGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-541s1c1
Sequence:CCGGGCTCGGAAAGAACGATACTTTCTCGAGAAAGTATCGTTCTTTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-1038s1c1
Sequence:CCGGGAGTGTCTTATGTGTGTTGAACTCGAGTTCAACACACATAAGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052959
PANX3 MISSION shRNA Lentiviral Transduction Particles
pannexin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-742s1c1
Sequence:CCGGCTGCTAAGTGATGAGACCCATCTCGAGATGGGTCTCATCACTTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-842s1c1
Sequence:CCGGCCATATTGGTTCCAGTGATAACTCGAGTTATCACTGGAACCAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052959.2-1339s1c1
Sequence:CCGGGAGAAGACATAACCAAGACATCTCGAGATGTCTTGGTTATGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-541s1c1
Sequence:CCGGGCTCGGAAAGAACGATACTTTCTCGAGAAAGTATCGTTCTTTCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052959.2-1038s1c1
Sequence:CCGGGAGTGTCTTATGTGTGTTGAACTCGAGTTCAACACACATAAGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)