EMAIL THIS PAGE TO A FRIEND

PAOX

polyamine oxidase (exo-N4-amino)

134 Gene Product Result for
Synonyms: PAO
Gene ID:
Mouse(212503) polyamine oxidase (exo-N4-amino)
Rat(293589) polyamine oxidase (exo-N4-amino)
chicken(100857693) peroxisomal N(1)-acetyl-spermine/spermidine oxidase-like
cow(282639) polyamine oxidase (exo-N4-amino)
domestic cat(101090142) polyamine oxidase (exo-N4-amino)
sheep(101111594) polyamine oxidase (exo-N4-amino)
Domestic Rabbit(100341296) polyamine oxidase (exo-N4-amino)
naked mole-rat(101697041) polyamine oxidase (exo-N4-amino)
domestic guinea pig(100725437) polyamine oxidase (exo-N4-amino)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152911 Rosetta Predictions human pricing
NM_207127 Rosetta Predictions human pricing
NM_207128 Rosetta Predictions human pricing
NM_001106311 Rosetta Predictions rat pricing
XM_238146 Rosetta Predictions rat pricing
NM_153783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035355 predicted 458
2 SASI_Hs01_00035356 predicted 470
3 SASI_Hs01_00035357 predicted 608
4 SASI_Hs01_00035360 predicted 248
5 SASI_Hs01_00035361 predicted 497
6 SASI_Hs01_00035362 predicted 470
7 SASI_Hs01_00035358 predicted 504
8 SASI_Hs01_00035359 predicted 586
9 SASI_Hs01_00035363 predicted 547
10 SASI_Hs02_00366885 predicted 1744
11 SASI_Hs01_00035364 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219966 predicted 461
2 SASI_Hs01_00219967 predicted 465
3 SASI_Hs01_00219968 predicted 607
4 SASI_Hs01_00219971 predicted 247
5 SASI_Hs01_00219972 predicted 497
6 SASI_Hs01_00219973 predicted 474
7 SASI_Hs01_00219969 predicted 503
8 SASI_Hs01_00219970 predicted 588
9 SASI_Hs01_00219974 predicted 546
10 SASI_Hs02_00373781 predicted 939
11 SASI_Hs01_00219975 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079070 predicted 454
2 SASI_Hs01_00079071 predicted 470
3 SASI_Hs01_00079072 predicted 607
4 SASI_Hs01_00079075 predicted 248
5 SASI_Hs01_00079076 predicted 501
6 SASI_Hs01_00079077 predicted 468
7 SASI_Hs01_00079073 predicted 500
8 SASI_Hs01_00079074 predicted 584
9 SASI_Hs01_00079078 predicted 543
10 SASI_Hs02_00373782 predicted 1589
11 SASI_Hs01_00079079 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217728 predicted 450
2 SASI_Rn02_00217729 predicted 1186
3 SASI_Rn02_00217730 predicted 442
4 SASI_Rn02_00217731 predicted 1010
5 SASI_Rn02_00217732 predicted 609
6 SASI_Rn02_00217733 predicted 532
7 SASI_Rn02_00217734 predicted 1230
8 SASI_Rn02_00217735 predicted 1542
9 SASI_Rn02_00217736 predicted 1180
10 SASI_Rn02_00217737 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00197202 predicted 1054
2 SASI_Rn01_00197203 predicted 969
3 SASI_Rn01_00197204 predicted 1043
4 SASI_Rn01_00197205 predicted 1035
5 SASI_Rn01_00197206 predicted 917
6 SASI_Rn01_00197207 predicted 1071
7 SASI_Rn01_00197208 predicted 586
8 SASI_Rn01_00197209 predicted 868
9 SASI_Rn01_00197210 predicted 746
10 SASI_Rn01_00197211 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190524 predicted 531
2 SASI_Mm01_00190525 predicted 437
3 SASI_Mm01_00190526 predicted 1225
4 SASI_Mm02_00343506 predicted 1146
5 SASI_Mm01_00190527 predicted 757
6 SASI_Mm01_00190528 predicted 393
7 SASI_Mm01_00190529 predicted 567
8 SASI_Mm01_00190530 predicted 811
9 SASI_Mm01_00190531 predicted 1178
10 SASI_Mm01_00190532 predicted 1259
11 SASI_Mm01_00190533 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152911
PAOX MISSION shRNA Bacterial Glycerol Stock
polyamine oxidase (exo-N4-amino)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-475s21c1
Sequence:CCGGCTCTGTTCTACGGCCTGATAGCTCGAGCTATCAGGCCGTAGAACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1005s1c1
Sequence:CCGGGCAGAAGCAATCAGGAAGATACTCGAGTATCTTCCTGATTGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-549s1c1
Sequence:CCGGGAGTACCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-748s1c1
Sequence:CCGGAGGGCTATCAAGGACTCACAACTCGAGTTGTGAGTCCTTGATAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1209s1c1
Sequence:CCGGCACGTTCTCTGTGGGTTCATTCTCGAGAATGAACCCACAGAGAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-474s1c1
Sequence:CCGGACTCTGTTCTACGGCCTGATACTCGAGTATCAGGCCGTAGAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-750s21c1
Sequence:CCGGGGCTATCAAGGACTCACAAACCTCGAGGTTTGTGAGTCCTTGATAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152911.2-1666s21c1
Sequence:CCGGCTCATTTCTTCTGACAGATTTCTCGAGAAATCTGTCAGAAGAAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152911
PAOX MISSION shRNA shRNA Plasmid DNA
polyamine oxidase (exo-N4-amino)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-475s21c1
Sequence:CCGGCTCTGTTCTACGGCCTGATAGCTCGAGCTATCAGGCCGTAGAACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1005s1c1
Sequence:CCGGGCAGAAGCAATCAGGAAGATACTCGAGTATCTTCCTGATTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-549s1c1
Sequence:CCGGGAGTACCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-748s1c1
Sequence:CCGGAGGGCTATCAAGGACTCACAACTCGAGTTGTGAGTCCTTGATAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1209s1c1
Sequence:CCGGCACGTTCTCTGTGGGTTCATTCTCGAGAATGAACCCACAGAGAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-474s1c1
Sequence:CCGGACTCTGTTCTACGGCCTGATACTCGAGTATCAGGCCGTAGAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-750s21c1
Sequence:CCGGGGCTATCAAGGACTCACAAACCTCGAGGTTTGTGAGTCCTTGATAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152911.2-1666s21c1
Sequence:CCGGCTCATTTCTTCTGACAGATTTCTCGAGAAATCTGTCAGAAGAAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152911
PAOX MISSION shRNA Lentiviral Transduction Particles
polyamine oxidase (exo-N4-amino)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-475s21c1
Sequence:CCGGCTCTGTTCTACGGCCTGATAGCTCGAGCTATCAGGCCGTAGAACAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1005s1c1
Sequence:CCGGGCAGAAGCAATCAGGAAGATACTCGAGTATCTTCCTGATTGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-549s1c1
Sequence:CCGGGAGTACCTCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGAGGTACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-748s1c1
Sequence:CCGGAGGGCTATCAAGGACTCACAACTCGAGTTGTGAGTCCTTGATAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-1209s1c1
Sequence:CCGGCACGTTCTCTGTGGGTTCATTCTCGAGAATGAACCCACAGAGAACGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152911.2-474s1c1
Sequence:CCGGACTCTGTTCTACGGCCTGATACTCGAGTATCAGGCCGTAGAACAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152911.2-750s21c1
Sequence:CCGGGGCTATCAAGGACTCACAAACCTCGAGGTTTGTGAGTCCTTGATAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152911.2-1666s21c1
Sequence:CCGGCTCATTTCTTCTGACAGATTTCTCGAGAAATCTGTCAGAAGAAATGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153783
PAOX MISSION shRNA Bacterial Glycerol Stock
polyamine oxidase (exo-N4-amino)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-560s1c1
Sequence:CCGGAGCTGGCTATCCTGAATACTTCTCGAGAAGTATTCAGGATAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153783.2-1587s1c1
Sequence:CCGGCTGACCAAGCTCTGTTTGGTTCTCGAGAACCAAACAGAGCTTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1435s1c1
Sequence:CCGGGAAGCCACACATCGGACATTTCTCGAGAAATGTCCGATGTGTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-411s1c1
Sequence:CCGGCCGTCTGTTCTATGGACTGATCTCGAGATCAGTCCATAGAACAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1089s1c1
Sequence:CCGGCCAAGACACCTGGTTCAAGAACTCGAGTTCTTGAACCAGGTGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153783
PAOX MISSION shRNA shRNA Plasmid DNA
polyamine oxidase (exo-N4-amino)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-560s1c1
Sequence:CCGGAGCTGGCTATCCTGAATACTTCTCGAGAAGTATTCAGGATAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153783.2-1587s1c1
Sequence:CCGGCTGACCAAGCTCTGTTTGGTTCTCGAGAACCAAACAGAGCTTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1435s1c1
Sequence:CCGGGAAGCCACACATCGGACATTTCTCGAGAAATGTCCGATGTGTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-411s1c1
Sequence:CCGGCCGTCTGTTCTATGGACTGATCTCGAGATCAGTCCATAGAACAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1089s1c1
Sequence:CCGGCCAAGACACCTGGTTCAAGAACTCGAGTTCTTGAACCAGGTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153783
PAOX MISSION shRNA Lentiviral Transduction Particles
polyamine oxidase (exo-N4-amino)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-560s1c1
Sequence:CCGGAGCTGGCTATCCTGAATACTTCTCGAGAAGTATTCAGGATAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153783.2-1587s1c1
Sequence:CCGGCTGACCAAGCTCTGTTTGGTTCTCGAGAACCAAACAGAGCTTGGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1435s1c1
Sequence:CCGGGAAGCCACACATCGGACATTTCTCGAGAAATGTCCGATGTGTGGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-411s1c1
Sequence:CCGGCCGTCTGTTCTATGGACTGATCTCGAGATCAGTCCATAGAACAGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153783.2-1089s1c1
Sequence:CCGGCCAAGACACCTGGTTCAAGAACTCGAGTTCTTGAACCAGGTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)