EMAIL THIS PAGE TO A FRIEND

PAPLN

papilin, proteoglycan-like sulfated glycoprotein

62 Gene Product Result for
Gene ID:
Mouse(170721) papilin, proteoglycan-like sulfated glycoprotein
Rat(314297) papilin, proteoglycan-like sulfated glycoprotein
domestic guinea pig(100728435) papilin, proteoglycan-like sulfated glycoprotein
Domestic Rabbit(100344004) papilin, proteoglycan-like sulfated glycoprotein
naked mole-rat(101715641) papilin, proteoglycan-like sulfated glycoprotein
sheep(101103901) papilin, proteoglycan-like sulfated glycoprotein
Zebrafish(562930) papilin, proteoglycan-like sulfated glycoprotein
chicken(428873) papilin, proteoglycan-like sulfated glycoprotein
cow(614084) papilin, proteoglycan-like sulfated glycoprotein
domestic cat(101091790) papilin, proteoglycan-like sulfated glycoprotein
dog(490769) papilin, proteoglycan-like sulfated glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079601 MISSION® esiRNA esiRNA human PAPLN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173462 Rosetta Predictions human pricing
NM_001108039 Rosetta Predictions rat pricing
NM_130887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213818 predicted 3766
2 SASI_Hs01_00213819 predicted 3457
3 SASI_Hs01_00213820 predicted 3469
4 SASI_Hs01_00213821 predicted 434
5 SASI_Hs02_00368199 predicted 3769
6 SASI_Hs02_00368200 predicted 662
7 SASI_Hs01_00213822 predicted 2343
8 SASI_Hs01_00213823 predicted 3128
9 SASI_Hs01_00213824 predicted 2186
10 SASI_Hs01_00213826 predicted 2985
11 SASI_Hs01_00213825 predicted 399
12 SASI_Hs01_00213827 predicted 2697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234755 predicted 1733
2 SASI_Rn02_00234756 predicted 2272
3 SASI_Rn02_00234757 predicted 3199
4 SASI_Rn02_00234758 predicted 3407
5 SASI_Rn02_00234759 predicted 2646
6 SASI_Rn02_00234760 predicted 1721
7 SASI_Rn02_00234761 predicted 2510
8 SASI_Rn02_00234762 predicted 1786
9 SASI_Rn02_00234763 predicted 2254
10 SASI_Rn02_00234764 predicted 2966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166014 predicted 739
2 SASI_Mm01_00166015 predicted 3629
3 SASI_Mm01_00166016 predicted 415
4 SASI_Mm01_00166017 predicted 670
5 SASI_Mm01_00166019 predicted 3022
6 SASI_Mm01_00166020 predicted 3403
7 SASI_Mm01_00166021 predicted 3814
8 SASI_Mm02_00338322 predicted 571
9 SASI_Mm01_00166022 predicted 3561
10 SASI_Mm01_00166023 predicted 2953
11 SASI_Mm01_00166018 predicted 2404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173462
PAPLN MISSION shRNA Bacterial Glycerol Stock
papilin, proteoglycan-like sulfated glycoprotein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173462.3-4151s21c1
Sequence:CCGGGTTACACAGGAATAGTTAAATCTCGAGATTTAACTATTCCTGTGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-658s21c1
Sequence:CCGGGCAGGCACCTTTGACGCTAATCTCGAGATTAGCGTCAAAGGTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3570s21c1
Sequence:CCGGAGATGGCACGCTGCTCATTTACTCGAGTAAATGAGCAGCGTGCCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3773s21c1
Sequence:CCGGAGCTTTGTGGCAATGAGTATTCTCGAGAATACTCATTGCCACAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-2987s21c1
Sequence:CCGGAGATCCAACTTCGCATCATAGCTCGAGCTATGATGCGAAGTTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-2302s1c1
Sequence:CCGGCCAATGTAACCGCTTCTGGTACTCGAGTACCAGAAGCGGTTACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173462.2-4048s1c1
Sequence:CCGGGCAATCTGTTTGGATAAGAAACTCGAGTTTCTTATCCAAACAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3419s1c1
Sequence:CCGGGCCAGGCTATTGTGTGTGGTACTCGAGTACCACACACAATAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-388s1c1
Sequence:CCGGCCCAAACAAGTGTGAACTGAACTCGAGTTCAGTTCACACTTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3085s1c1
Sequence:CCGGGCCTGCAAACAGGCTGCGTTTCTCGAGAAACGCAGCCTGTTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173462
PAPLN MISSION shRNA shRNA Plasmid DNA
papilin, proteoglycan-like sulfated glycoprotein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173462.3-4151s21c1
Sequence:CCGGGTTACACAGGAATAGTTAAATCTCGAGATTTAACTATTCCTGTGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-658s21c1
Sequence:CCGGGCAGGCACCTTTGACGCTAATCTCGAGATTAGCGTCAAAGGTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3570s21c1
Sequence:CCGGAGATGGCACGCTGCTCATTTACTCGAGTAAATGAGCAGCGTGCCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3773s21c1
Sequence:CCGGAGCTTTGTGGCAATGAGTATTCTCGAGAATACTCATTGCCACAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-2987s21c1
Sequence:CCGGAGATCCAACTTCGCATCATAGCTCGAGCTATGATGCGAAGTTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-2302s1c1
Sequence:CCGGCCAATGTAACCGCTTCTGGTACTCGAGTACCAGAAGCGGTTACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173462.2-4048s1c1
Sequence:CCGGGCAATCTGTTTGGATAAGAAACTCGAGTTTCTTATCCAAACAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3419s1c1
Sequence:CCGGGCCAGGCTATTGTGTGTGGTACTCGAGTACCACACACAATAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-388s1c1
Sequence:CCGGCCCAAACAAGTGTGAACTGAACTCGAGTTCAGTTCACACTTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3085s1c1
Sequence:CCGGGCCTGCAAACAGGCTGCGTTTCTCGAGAAACGCAGCCTGTTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173462
PAPLN MISSION shRNA Lentiviral Transduction Particles
papilin, proteoglycan-like sulfated glycoprotein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173462.3-4151s21c1
Sequence:CCGGGTTACACAGGAATAGTTAAATCTCGAGATTTAACTATTCCTGTGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-658s21c1
Sequence:CCGGGCAGGCACCTTTGACGCTAATCTCGAGATTAGCGTCAAAGGTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3570s21c1
Sequence:CCGGAGATGGCACGCTGCTCATTTACTCGAGTAAATGAGCAGCGTGCCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-3773s21c1
Sequence:CCGGAGCTTTGTGGCAATGAGTATTCTCGAGAATACTCATTGCCACAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173462.3-2987s21c1
Sequence:CCGGAGATCCAACTTCGCATCATAGCTCGAGCTATGATGCGAAGTTGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-2302s1c1
Sequence:CCGGCCAATGTAACCGCTTCTGGTACTCGAGTACCAGAAGCGGTTACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173462.2-4048s1c1
Sequence:CCGGGCAATCTGTTTGGATAAGAAACTCGAGTTTCTTATCCAAACAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3419s1c1
Sequence:CCGGGCCAGGCTATTGTGTGTGGTACTCGAGTACCACACACAATAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-388s1c1
Sequence:CCGGCCCAAACAAGTGTGAACTGAACTCGAGTTCAGTTCACACTTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173462.2-3085s1c1
Sequence:CCGGGCCTGCAAACAGGCTGCGTTTCTCGAGAAACGCAGCCTGTTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130887
PAPLN MISSION shRNA Bacterial Glycerol Stock
papilin, proteoglycan-like sulfated glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-401s1c1
Sequence:CCGGCCCTAATAAGTGTGAGCTGAACTCGAGTTCAGCTCACACTTATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-1044s1c1
Sequence:CCGGCGCCTGGTATTCTGCACTATTCTCGAGAATAGTGCAGAATACCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-2420s1c1
Sequence:CCGGCGCCAATAACTTTGCATCGGACTCGAGTCCGATGCAAAGTTATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-750s1c1
Sequence:CCGGCGTGGCGAGTACTATCTCAATCTCGAGATTGAGATAGTACTCGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130887.1-4092s1c1
Sequence:CCGGTGTGAAGAAGAGGAACCCTTTCTCGAGAAAGGGTTCCTCTTCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130887
PAPLN MISSION shRNA shRNA Plasmid DNA
papilin, proteoglycan-like sulfated glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-401s1c1
Sequence:CCGGCCCTAATAAGTGTGAGCTGAACTCGAGTTCAGCTCACACTTATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-1044s1c1
Sequence:CCGGCGCCTGGTATTCTGCACTATTCTCGAGAATAGTGCAGAATACCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-2420s1c1
Sequence:CCGGCGCCAATAACTTTGCATCGGACTCGAGTCCGATGCAAAGTTATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-750s1c1
Sequence:CCGGCGTGGCGAGTACTATCTCAATCTCGAGATTGAGATAGTACTCGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130887.1-4092s1c1
Sequence:CCGGTGTGAAGAAGAGGAACCCTTTCTCGAGAAAGGGTTCCTCTTCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130887
PAPLN MISSION shRNA Lentiviral Transduction Particles
papilin, proteoglycan-like sulfated glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-401s1c1
Sequence:CCGGCCCTAATAAGTGTGAGCTGAACTCGAGTTCAGCTCACACTTATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-1044s1c1
Sequence:CCGGCGCCTGGTATTCTGCACTATTCTCGAGAATAGTGCAGAATACCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-2420s1c1
Sequence:CCGGCGCCAATAACTTTGCATCGGACTCGAGTCCGATGCAAAGTTATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130887.1-750s1c1
Sequence:CCGGCGTGGCGAGTACTATCTCAATCTCGAGATTGAGATAGTACTCGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130887.1-4092s1c1
Sequence:CCGGTGTGAAGAAGAGGAACCCTTTCTCGAGAAAGGGTTCCTCTTCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)